On Saturday, 23 June 2018 at 13:45:32 UTC, Basile B. wrote:
On Saturday, 23 June 2018 at 12:17:08 UTC, biocyberman wrote:
I get the same output with or without "g" flag at line 6:
https://run.dlang.io/is/9n7iz6
So I don't understand when I have to use "g" flag.
My bet is that Regex results
On Saturday, 23 June 2018 at 12:20:10 UTC, biocyberman wrote:
I got "Error: undefined identifier flags" in here:
https://run.dlang.io/is/wquscz
Removing "flags =" works.
I kinda found an answer. It's a bit of a surprise anyway:
I got "Error: undefined identifier flags" in here:
https://run.dlang.io/is/wquscz
Removing "flags =" works.
I get the same output with or without "g" flag at line 6:
https://run.dlang.io/is/9n7iz6
So I don't understand when I have to use "g" flag.
On Friday, 1 June 2018 at 10:15:11 UTC, Martin Tschierschke wrote:
On Friday, 1 June 2018 at 09:49:23 UTC, biocyberman wrote:
I need to convert a compressed 17GB SQL dump to CSV. A
workable solution is to create a temporary mysql database,
import the dump, query by python, and export. But i
I need to convert a compressed 17GB SQL dump to CSV. A workable
solution is to create a temporary mysql database, import the
dump, query by python, and export. But i wonder if there is
something someway in D to parse the SQL file directly and query
and export the data. I imagine this will
On Wednesday, 30 May 2018 at 10:07:35 UTC, Simen Kjærås wrote:
On Wednesday, 30 May 2018 at 09:58:16 UTC, biocyberman wrote:
[...]
This line:
writeln("got num: %s, of type: %s", num, typeof(num));
[...]
Problem solved. Thanks Simen!
How do I add logging for this struct?
https://run.dlang.io/is/9N6N4o
If not possible, what's the alternative?
On Thursday, 24 May 2018 at 17:44:19 UTC, Jacob Carlborg wrote:
On 2018-05-24 11:10, biocyberman wrote:
Thanks for the hints. `Read` in C++ and D are both classes.
And the function is inside the class definition itself.
In that case specifying the type as `Read` is the correct thing
to do.
On Thursday, 24 May 2018 at 12:34:38 UTC, Steven Schveighoffer
wrote:
On 5/24/18 8:08 AM, rikki cattermole wrote:
On 25/05/2018 12:06 AM, biocyberman wrote:
I am testing with DMD 2.078.2 locally. This tiny snippet
works on dlang's online editor: https://run.dlang.io/is/nb4IV4
But it does not
I am testing with DMD 2.078.2 locally. This tiny snippet works on
dlang's online editor: https://run.dlang.io/is/nb4IV4
But it does not work on my local dmd.
import std.algorithm.mutation;
import std.stdio;
char[] arr = "hello\U00010143\u0100\U00010143".dup;
writeln(arr.reverse);
Error:
On Thursday, 24 May 2018 at 08:58:02 UTC, Nicholas Wilson wrote:
On Thursday, 24 May 2018 at 08:16:30 UTC, biocyberman wrote:
[...]
it looks like Read is a D class? in which case it already
returns by reference.
If you make Read a struct then all you need do is change the
function signature
On Wednesday, 23 May 2018 at 03:12:52 UTC, IntegratedDimensions
wrote:
On Wednesday, 23 May 2018 at 03:00:17 UTC, Nicholas Wilson
wrote:
[...]
I knew someone was going to say that and I forgot to say DON'T!
Saying to profile when I clearly said these ARE cases where
they are slow is just
Some C and C++ projects I am working on use pointers and
references extensively: to pass as function arguments, and to
return from a function. For function argument I would use `ref`,
but for return types, I can't use `ref` and can't return a
pointer. What should be the proper way to handle
On Friday, 4 May 2018 at 14:13:19 UTC, Luís Marques wrote:
On Monday, 30 April 2018 at 18:47:21 UTC, biocyberman wrote:
I am attending Dconf 2018 and giving a talk there on May 4.
Link: https://dconf.org/2018/talks/le.html. It will be very
interesting to talk about the outcome of the following
On Monday, 30 April 2018 at 20:34:41 UTC, Steven Schveighoffer
wrote:
On 4/30/18 2:47 PM, biocyberman wrote:
Hellow D community.
I am attending Dconf 2018 and giving a talk there on May 4.
Link: https://dconf.org/2018/talks/le.html. It will be very
interesting to talk about the outcome of
Hellow D community.
I am attending Dconf 2018 and giving a talk there on May 4. Link:
https://dconf.org/2018/talks/le.html. It will be very interesting
to talk about the outcome of the following challenges. If we
can't have at least 3 solutions by three individuals by 10:00
GMT+2 May 4, I
On Thursday, 22 February 2018 at 08:43:24 UTC, ketmar wrote:
Nick Sabalausky (Abscissa) wrote:
[...]
from my experience (various codebases up to middle size, mostly
C, some C++): fsck the "one module at a time" idea! even in D
modules are interwined, and in C and C++ they're even more so.
For someone using NFS or some other remote filesystems, one may
have experienced many times the nasty silent hang. For example,
if I run `ls /mnt/remote/nfsmount`, and the remote NFS server is
down while /mnt/remote/nfsmount was mounted, it will take very
long time or forever for the `ls`
On Wednesday, 23 August 2017 at 13:06:36 UTC, Steven
Schveighoffer wrote:
On 8/23/17 5:53 AM, biocyberman wrote:
[...]
I'll respond to all your questions with what I would do,
instead of answering each one.
I would suggest an approach similar to how I approached parsing
JSON data. In your
I lost my momentum to learn D and want to gain it up again.
Therefore I need some help with this seemingly simple task:
# Fasta sequence
\>Entry1_ID header field1|header field2|...
CAGATATCTTTGATGTCCTGATTGGAAGGACCGTTGGCCACCCTTAGGCAG
TGTATACTCTTCCATAAACGAGCTATTAGTTATGAGGTCCGTAGATTGGGG
Following is the code for a more generalized Fibonacci range.
Questions:
1. How do I get only the value of the Nth (i.e. N = 25) element
in an idiomatic way?
2. Can I set constraints in the range so that user gets warning
if he asks for Nth element greater than a limit, say N> 30; or if
On Tuesday, 23 May 2017 at 10:10:24 UTC, Russel Winder wrote:
On Tue, 2017-05-23 at 07:40 +, biocyberman via
Digitalmars-d-learn wrote:
[…]
Adding DDOC support for D Mode require some more work
obviously. I will see if I can make some changes to that. For
the time being, I would like
On Monday, 22 May 2017 at 15:33:36 UTC, Russel Winder wrote:
On Mon, 2017-05-22 at 14:14 +, biocyberman via
Digitalmars-d-learn wrote:
Which one do you use? I am using Linux and Emacs for editing
other D source file. But the DDOC syntaxes and keywords are
not well high-lighted.
There has
Which one do you use? I am using Linux and Emacs for editing
other D source file. But the DDOC syntaxes and keywords are not
well high-lighted.
On Monday, 22 May 2017 at 13:11:15 UTC, Andrew Edwards wrote:
Sorry if this is a stupid question but it eludes me. In the
following, what is THING? What is SOME_THING?
#ifndef THING
#define THING
#endif
#ifndef SOME_THING
#define SOME_THING THING *
#endif
Is this
On Monday, 22 May 2017 at 10:35:36 UTC, ag0aep6g wrote:
On 05/22/2017 10:58 AM, biocyberman wrote:
[...]
For reference, here is the version of revComp3 I commented on:
string revComp3(string bps) {
const N = bps.length;
enum chars = [Repeat!('A'-'\0', '\0'), 'T',
On Monday, 22 May 2017 at 06:50:45 UTC, Biotronic wrote:
On Friday, 19 May 2017 at 22:53:39 UTC, crimaniak wrote:
On Friday, 19 May 2017 at 12:55:05 UTC, Biotronic wrote:
revComp6 seems to be the fastest, but it's probably also the
least readable (a common trade-off).
Try revComp7 with
On Friday, 19 May 2017 at 09:17:04 UTC, Biotronic wrote:
On Friday, 19 May 2017 at 07:29:44 UTC, biocyberman wrote:
[...]
Question about your implementation: you assume the input may
contain newlines, but don't handle any other non-ACGT
characters. The problem definition states 'DNA string'
On Friday, 19 May 2017 at 07:46:13 UTC, Stefan Koch wrote:
On Friday, 19 May 2017 at 07:29:44 UTC, biocyberman wrote:
I am solving this problem http://rosalind.info/problems/revc/
as an exercise to learn D. This is my solution:
https://dpaste.dzfl.pl/8aa667f962b7
Is there some D tricks I can
I am solving this problem http://rosalind.info/problems/revc/ as
an exercise to learn D. This is my solution:
https://dpaste.dzfl.pl/8aa667f962b7
Is there some D tricks I can use to make the `reverseComplement`
function more concise and speedy? Any other comments for
improvement of the whole
On Thursday, 18 May 2017 at 10:05:41 UTC, Jonathan M Davis wrote:
On Thursday, May 18, 2017 09:56:36 biocyberman via
Digitalmars-d-learn wrote:
[...]
My point is that it's a private function for testing std.stdio
and not intended to be part of the public API or be used by
anyone else (it's
On Thursday, 18 May 2017 at 09:49:26 UTC, Jonathan M Davis wrote:
On Thursday, May 18, 2017 09:40:33 biocyberman via
Digitalmars-d-learn wrote:
[...]
Actually, it's not used all over the place in Phobos. It's only
used std.stdio, where it's a private function in a
version(unittest) block
This is the compile error message by the way:
dmd -unittest ./testFile.d
There is a ongoing discussion about temp file over here:
http://forum.dlang.org/thread/sbehcxusxxibmpkae...@forum.dlang.org
I have a question about generating a temporary file to write test
data. I can create my own file and use it but just want to use
the existing tool for convenience.
On Monday, 15 May 2017 at 21:38:52 UTC, Yuxuan Shui wrote:
Suppose I have a
struct A {
@disable this(this);
} x;
How do I append it into an array?
Do I have to do
array.length++;
moveEmplace(x, array[$-1]);
?
Judging form the way you write the struct. It is of C/C++ style.
With that
On Saturday, 8 April 2017 at 21:34:30 UTC, Ali Çehreli wrote:
You can mixin declarations with a template but I don't see how
it can help here. A string mixin would work but it's really
ugly at the use site:
string roundUp(alias x)()
if (is (typeof(x) == uint)) {
import std.string :
On Saturday, 8 April 2017 at 11:24:02 UTC, Nicholas Wilson wrote:
The ':' means that it applies to everything that follows it, so
while it doesn't matters in this example if you had
pragma( inline, true ):
int kroundup32( int x) { ... }
auto someVeryLargeFunction( Args args)
{
// ...
}
On Saturday, 8 April 2017 at 10:09:47 UTC, Mike Parker wrote:
T kroundup32(T)(T x) {
pragma(inline, true);
--(x);
(x)|=(x)>>1;
(x)|=(x)>>2;
(x)|=(x)>>4;
(x)|=(x)>>8;
(x)|=(x)>>16;
return ++(x);
}
I also came up with this:
import std.stdio;
pragma( inline, true
On Saturday, 8 April 2017 at 10:02:01 UTC, Mike Parker wrote:
I would expect if you implement it as a function the compiler
will inline it. You can always use the pragma(inline, true) [1]
with -inline to verify.
[1] https://dlang.org/spec/pragma.html#inline
Thanks for mentioning pragma.
What is the D mixin version equivalent to this macro:
#define kroundup32(x) (--(x), (x)|=(x)>>1, (x)|=(x)>>2,
(x)|=(x)>>4, (x)|=(x)>>8, (x)|=(x)>>16, ++(x))
The macro looks cryptic. What the macro does has been explained
here:
On Friday, 7 April 2017 at 23:53:12 UTC, Ali Çehreli wrote:
The difference is that you can't use funcgen as a regular
template:
funcgen!(void, void);
Error: template instance funcgen!(void, void) mixin templates
are not regular templates
I think it's good practice to use 'mixin
I want to use mixin to generate function in-place. In template
declaration, I can see 'mixin' keyword is optional. Is it true?
What is the difference and when I must use one way over another?
This is my program:
// This works with and without 'mixin' attribute.
mixin template funcgen(T, U){
On Monday, 3 April 2017 at 23:10:49 UTC, Stefan Koch wrote:
On Monday, 3 April 2017 at 11:18:21 UTC, Nicholas Wilson wrote:
prefer template over string mixins where possible. This
will make the code much more readable.
My advise would be the opposite.
templates put much more pressure on
On Tuesday, 4 April 2017 at 05:29:42 UTC, Ali Çehreli wrote:
Covert has a very different meaning. :)
Ali
Thanks Ali. My fingers argued they are the same :) And I can't
find a way to edit my post after posting.
I would love to have your input. I am revisited your book
several times to
On Monday, 3 April 2017 at 00:00:04 UTC, Nicholas Wilson wrote:
On Sunday, 2 April 2017 at 21:43:52 UTC, biocyberman wrote:
template __KHASH_TYPE(string name){
"struct kh_" ~ name ~"_t { " ~
"khint_t n_buckets, size, n_occupied,
upper_bound; " ~
"khint32_t
khash.h
(http://attractivechaos.github.io/klib/#Khash%3A%20generic%20hash%20table) is a part of klib library in C. I want to covert it to D in the process of learning deeper about D.
First I tried with Dstep
(https://github.com/jacob-carlborg/dstep) and read the C to D
article
@Laeeth Isharc and rikki cattermole: Thank you for your inputs.
Msgpack is definitely something I will consider. I tried search
some show cases and open-source projects of this kind for Dlang
but still haven't found one. Those applications will give clearer
ideas.
I am considering to use D and its library to build a high
performance client-server application. The client will be a cross
platform (Windows, Mac, Linux) GUI program that can synchronize
analysis results with the remote central server, and analyze data
locally. It will also visualize big data
On Monday, 19 December 2016 at 16:23:45 UTC, Guillaume Piolat
wrote:
What you can do for private package as of today is:
- use path-based dependencies and put your packages in the same
repo
- use git submodules and path-based dub dependencies together
If it's a public package, you can
On Monday, 19 December 2016 at 14:18:17 UTC, Jacob Carlborg wrote:
On 2016-12-19 13:11, biocyberman wrote:
I can write a short script to clone the remote git repo and
use it as a
submodule. But if it is possible to do with dub, it will be
more
convenient.
It's not currently possible.
I
I can write a short script to clone the remote git repo and use
it as a submodule. But if it is possible to do with dub, it will
be more convenient.
52 matches
Mail list logo