I lost my momentum to learn D and want to gain it up again.
Therefore I need some help with this seemingly simple task:
# Fasta sequence
\>Entry1_ID header field1|header field2|...
CAGATATCTTTGATGTCCTGATTGGAAGGACCGTTGGCCACCCTTAGGCAG
TGTATACTCTTCCATAAACGAGCTATTAGTTATGAGGTCCGTAGATTGGGG
Hi All,
Can anyone provide me a example code on how to read a parameter
file and use those parameter in the program.
From,
Vino.B
On Wednesday, 23 August 2017 at 10:25:48 UTC, Vino.B wrote:
Hi All,
Can anyone provide me a example code on how to read a
parameter file and use those parameter in the program.
From,
Vino.B
Parameter file is a plain text file, with some structure. I've
seen in other languages people use
On Wednesday, 23 August 2017 at 09:53:49 UTC, biocyberman wrote:
I lost my momentum to learn D and want to gain it up again.
Therefore I need some help with this seemingly simple task:
# Fasta sequence
\>Entry1_ID header field1|header field2|...
CAGATATCTTTGATGTCCTGATTGGAAGGACCGTTGGCCACC
On Wednesday, 23 August 2017 at 10:25:48 UTC, Vino.B wrote:
Hi All,
Can anyone provide me a example code on how to read a
parameter file and use those parameter in the program.
From,
Vino.B
For small tools I use JSON files via asdf[1].
As an example you can look at the tunneled settings s
On Wednesday, 23 August 2017 at 05:53:46 UTC, ag0aep6g wrote:
On 08/23/2017 07:45 AM, Vino.B wrote:
Execution :
rdmd Summary.d - Not working
rdmd Summary.d test - Working
Program:
void main (string[] args)
{
if(args.length != 2 )
writefln("Unknown operation: %s", args[1]);
}
When args
On Wednesday, 23 August 2017 at 05:06:50 UTC, Vino.B wrote:
Hi All,
When i run the below code in windows i am getting "The system
cannot find the path specified" even though the path exist ,
the length of the path is 516 as below, request your help.
Path :
N:\PROD_TEAM\TST_BACKUP\abcyf0\TS
On Wednesday, 23 August 2017 at 11:29:07 UTC, Moritz Maxeiner
wrote:
On Wednesday, 23 August 2017 at 05:06:50 UTC, Vino.B wrote:
Hi All,
When i run the below code in windows i am getting "The
system cannot find the path specified" even though the path
exist , the length of the path is 516 a
On Wednesday, 23 August 2017 at 11:18:14 UTC, Moritz Maxeiner
wrote:
On Wednesday, 23 August 2017 at 05:53:46 UTC, ag0aep6g wrote:
On 08/23/2017 07:45 AM, Vino.B wrote:
Execution :
rdmd Summary.d - Not working
rdmd Summary.d test - Working
Program:
void main (string[] args)
{
if(args.length
On Wednesday, 23 August 2017 at 12:01:20 UTC, Vino.B wrote:
On Wednesday, 23 August 2017 at 11:29:07 UTC, Moritz Maxeiner
wrote:
On which line do you get the Exception? Does it happen with
shorter paths, as well?
Assuming it happens with all paths: Just to be sure, is each
of those backslashe
On Wednesday, 23 August 2017 at 05:06:50 UTC, Vino.B wrote:
Hi All,
When i run the below code in windows i am getting "The system
cannot find the path specified" even though the path exist ,
the length of the path is 516 as below, request your help.
Path :
N:\PROD_TEAM\TST_BACKUP\abcyf0\TS
On Tuesday, 22 August 2017 at 16:54:24 UTC, Igor wrote:
On Tuesday, 22 August 2017 at 12:03:18 UTC, Igor wrote:
On Monday, 21 August 2017 at 12:38:28 UTC, Mike Parker wrote:
Have you tried to compile outside of VisualD?
Hmmm... I though I tried running with just typing dub which
should use
On Wednesday, 23 August 2017 at 10:25:48 UTC, Vino.B wrote:
Hi All,
Can anyone provide me a example code on how to read a
parameter file and use those parameter in the program.
From,
Vino.B
Another small library:
https://github.com/burner/inifiled
On Tuesday, 22 August 2017 at 12:03:18 UTC, Igor wrote:
In the meantime can you tell me these two things:
1. How come DerelictGLES only has:
static if( Derelict_OS_Windows ) ...
else static if( Derelict_OS_Posix && !Derelict_OS_Mac )...
when GLES is primarily intended for mobile platforms as fa
On Wednesday, 23 August 2017 at 12:12:47 UTC, Moritz Maxeiner
wrote:
On Wednesday, 23 August 2017 at 12:01:20 UTC, Vino.B wrote:
On Wednesday, 23 August 2017 at 11:29:07 UTC, Moritz Maxeiner
wrote:
On which line do you get the Exception? Does it happen with
shorter paths, as well?
Assuming it
On 8/23/17 5:53 AM, biocyberman wrote:
I lost my momentum to learn D and want to gain it up again. Therefore I
need some help with this seemingly simple task:
# Fasta sequence
\>Entry1_ID header field1|header field2|...
CAGATATCTTTGATGTCCTGATTGGAAGGACCGTTGGCCACCCTTAGGCAG
TGTATACTCTTCCATA
On Wednesday, 23 August 2017 at 13:04:28 UTC, Vino.B wrote:
The line it complains is
std.file.FileException@std\file.d(3713):even after enabling
debug it points to the same
Output:
D:\DScript>rdmd -debug Test.d -r dryrun
std.file.FileException@std\file.d(3713):
N:\PROD_TEAM\TST_BACKUP\abc
On Wednesday, 23 August 2017 at 13:14:31 UTC, Moritz Maxeiner
wrote:
On Wednesday, 23 August 2017 at 13:04:28 UTC, Vino.B wrote:
The line it complains is
std.file.FileException@std\file.d(3713):even after enabling
debug it points to the same
Output:
D:\DScript>rdmd -debug Test.d -r dryrun
On Wednesday, 23 August 2017 at 12:59:38 UTC, Mike Parker wrote:
On Tuesday, 22 August 2017 at 12:03:18 UTC, Igor wrote:
[...]
I'm not sure what you're referring to. There are a few static
if(Derelict_OS_Android) blocks in there as well.
[...]
Ok Mike. Thanks for the info. If I learn any
On 22-08-17 21:28, Johnson wrote:
Thanks, that works!
Could you address some of my concerns:
1. I need to be able to get the raw data, is this easily possible with
gstreamer?
2. It's quite a big package 600mb+ total and about 150 for the bin and
150 for the lib. Eventually I want to suppor
I'm on a Windows 7 machine and I'm using VisualD as my IDE. I'm
trying to work out what's chewing up all the RAM in a program I'm
writing... is there a tool that I can use that'll show me what in
my program keeps allocating memory?
Thanks
Hi,
how does the D syntax highlighting in e.g.
https://dlang.org/blog/2017/08/23/d-as-a-better-c/ works?
From reading the html source code I understand there is some
functionality prettyprint but not how it is included and what I
have to do to use it in my page.
Kind regards
André
On Wednesday, 23 August 2017 at 17:30:40 UTC, Drake44 wrote:
I'm on a Windows 7 machine and I'm using VisualD as my IDE. I'm
trying to work out what's chewing up all the RAM in a program
I'm writing... is there a tool that I can use that'll show me
what in my program keeps allocating memory?
I recall seeing some C/C++/D code that optimizes the comment- and
whitespace-skipping parts (tokens) of lexers by operating on 2, 4
or 8-byte chunks instead of single-byte chunks. This in the case
when token-terminators are expressed as sets of (alternative)
ASCII-characters.
For instance, wh
On Wednesday, 23 August 2017 at 20:03:16 UTC, Andre Pany wrote:
Hi,
how does the D syntax highlighting in e.g.
https://dlang.org/blog/2017/08/23/d-as-a-better-c/ works?
From reading the html source code I understand there is some
functionality prettyprint but not how it is included and what
I want to wrap:
ErrorEnum function(Struct* s, void function(Struct*, ErrorEnum
status, void *userData) callback, void *userData, uint flags);
as a member of a wrapping struct
struct Mystruct
{
Struct* s; // wrapped
ErrorEnum addCallback(void delegate(Struct*, ErrorEnum
status))
26 matches
Mail list logo