Hello Andrea,
Make a copy of the ~/tools/data_source/biomart.xml for your local biomart
install, and change the action in the following tag to point to it.
inputs action=http://www.biomart.org/biomart/martview; check_values=false
method=get target=_top
Then add your new biomart tool wrapper
Lishiyong,
You should not convert colorspace to base space prior to aligning reads.
The reason for this is that if there is an error in one of the color
calls, it will effect all the downstream color calls.
Instead, you should use an aligner that will do the assembly in
color-space
Jo,
Use the SAM Tools SAM-TO-BAM tool in Galaxy to convert your SAM file to
a BAM file.
Ryan
On 3/25/11 10:35 AM, Jochen Seggewiß wrote:
Hi!
Thank you for your reply.
So that means, I should convert the csfasta qual to fastq, map it with
Bowtie, get an SAM, convert it to BAM and then
Hello collegues,
I have two questions which I could not get answered.
I have Illumina single end sequences files, and want to use them for ChIP-Seq
analysis.
My first question is:
In Galaxy screencasts (ChIP-Seq analysis for TAF1-protein...) he does not tell
how he has generated the txt. format
��
AGAGTGGCCAGCACATGAAGAAGATAACCGTGCGCCTTTTTCCGAA
But I think it should to be TCCTAGACAAGTTGGCTTTCCCTTAAACAGCTGACATAGAGATATGTCCC
Who knows the reason about this.
2011-03-28
lishiyong
-- next part --
An HTML attachment was scrubbed...
URL:http://lists.bx.psu.edu/pipermail/galaxy-user/attachments/20110328/43b70c8a
Hi Evan,
The update to include zebrafish (and a few other genomes) should roll
out to Galaxy main in the next few days, if not sooner. Feel free to
check back Friday for an update if you do not see it there by then.
Thank you for your patience!
Best,
Jen
Galaxy team
On 3/28/11 8:01 AM,
Hello,
I'm trying to download the library files I processed on my galaxy cloud
instance, but I'm getting an error. At the top (on the right panel) it
says Server Error and then lists the URL where the data should be and
then lists:
Module paste.exceptions.errormiddleware:143 in __call__
Hi Jen,
Many thanks for the reply. Sadly my programming is not up to anything like a
gbk to gtf converter! The main reason I want one is that as a virologist this
would be very useful since many viruses do not have a gtf file but do have
genbank submissions. I know of a site that has some
Hi Karl,
Hmm, not having Galaxy accessible is definitely not a step in the right
direction.
Being signed into command line is not an issue; something else must have
gone wrong. To start, please take a look at the (bottom of) galaxy log file
(and email the relevant part if you don't see how to fix
Listed on the hg19 gateway page at the UCSC genome browser.
- Original Message -
From: David Matthews d.a.matth...@bristol.ac.uk
To: Jennifer Jackson j...@bx.psu.edu
Cc: galaxy-u...@bx.psu.edu
Sent: Monday, March 28, 2011 2:04:02 PM
Subject: Re: [galaxy-user] Pseudo Autosomal regions in
You're almost there, the command should be executed from your local machine
(home directory is fine) and it should look as follows:
scp -i path to keyfile
ubuntu@publicDNS:/mnt/galaxyData/files/000/dataset_11.dat
.
(note the 'ubuntu@' before the public DNS and a trailing dot (.) - the dot
means
Hi David,
The PAR regions are documented at UCSC on the hg19 genome gateway page
(and for some other recent genomes). Start at the main page, click into
Genomes, select hg19, then scroll down to credits:
http://genome.ucsc.edu/
quote:
The Y chromosome in this assembly contains two
Excellent, it was the trailing dot that I was missing!
Thanks so much for the help, I will most certainly be using Galaxy again,
it's been very useful so far.
karl
You're almost there, the command should be executed from your local
machine
(home directory is fine) and it should look as
13 matches
Mail list logo
