[galaxy-user] cuffcompare inputs
Dear all, given 3 samples, 1 control and 2 treated replicates when I do cuffcompare to produce the gtf input for cuffdiff, do I have to run it with or without the cufflink control? E.g. Cuffcompare with only my 2 treated replicates?--use this gtf to run cuffdiff Cuffcompare 1 contro and 2 treated replicates?--use this gtf to run cuffdff Thanks a lot ib ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
[galaxy-user] reference genome format for tophat
Dear all, I managed to upload to Galaxy a genome of interest in .fasta format from NCIB website. However, Galaxy does not recognize it as input to run Tophat... Wht format has to be to be used as referece genome for tophat?and how can i convert it? Any suggestion? thanks, ib ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
[galaxy-user] Install Galaxy on Mac
Hello, Could someone provide instructions for installing galaxy on a Mac OS 10.7? The instructions provided by galaxy start off by asking me to check my python version, but I don't know how to do that. I figure someone has step-by-step instructions or a screen cast? Thank you, Edward ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
[galaxy-user] FASTQ splitter produced empty dataset, please help
I have problem to split a paired-end FASTQ dataset into two separate datasets. In order to explain the problem clearly, I list the detail of what I did with my dataset: Step 1) My aim is to compare datasets for the differential alternative splicing. I downloaded paired-end datasets at FASTQ format from SRA of NCBI as original data. Below is part of my paired-end FASTQ dataset that I downloaed from SRA of NCBI, Does this dataset look OK? @SRR192532.1.1 HWI-EAS269:1:4:655:110.1 length=35 GCTGAGTGAGGGTGTGTTTGGAGTTTG +SRR192532.1.1 HWI-EAS269:1:4:655:110.1 length=35 I28II;II*2/5:++,(..*943F@I.('+.35' @SRR192532.1.2 HWI-EAS269:1:4:655:110.2 length=35 AAAGATGTTAGTGATACGGAAAGGATATCTC +SRR192532.1.2 HWI-EAS269:1:4:655:110.2 length=35 9+*9+7@?F1206,IGI+D122/0++-.+6/@? Step 2) Then I performed FASTQ groomer at setting as follows: a) Input FASTQ quality scores type: Illumina 1.3-1.7 b)Advanced Options: Hide Advanced Options. Did I choose the right setting for FASTQ groomer? Should I use Advanced Options? If yes, what is the setting for Advances Options? Below is part of groomed dataset: @SRR192532.1.1 HWI-EAS269:1:4:655:110.1 length=35 GCTGAGTGAGGGTGTGTTTGGAGTTTG +SRR192532.1.1 HWI-EAS269:1:4:655:110.1 length=35 *!!**!**'!* @SRR192532.1.2 HWI-EAS269:1:4:655:110.2 length=35 AAAGATGTTAGTGATACGGAAAGGATATCTC +SRR192532.1.2 HWI-EAS269:1:4:655:110.2 length=35 '!*(*!% Does the groomed data look right? Is number represnting the member of a pair correct? Here they are .1 and .2, should they be /1 and /2? Step 3) Then I ran FASTQ splitter with the groomed files. There is not setting for the splitter. I chose the right groomed file and then click Excute. Below is the description of the splitted dataset: empty format: fastqsanger, database:hg19 Info: Split 0 of 15277248 reads (0.00%). Please help me dela with this problem. Thanks. Jianguang Du ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Install Galaxy on Mac
Both responses worked for checking python version, but trying to download gave an error: Install Galaxy on Mac OS10.7 1. Open Applications/Utilities/Terminal.app 2. Check Python version by pasting in python -V, no quotes, and hit return response = Python 2.7.1 3. Get Galaxy by pasting in % hg clone https://bitbucket.org/galaxy/galaxy-dist/;, no quotes, and hit return response = -bash: fg: %: no such job On Aug 10, 2012, at 8:58 AM, Hotz, Hans-Rudolf wrote: Hi Edward I am moving your e-mail to 'galaxy-dev' since it's about a local Galaxy instance. I don't think there are any differences between installing Galaxy on Linux and Mac OS X. Hence you can follow the step-by-step instructions on the wiki (well, there are actually only two steps anyway...): http://wiki.g2.bx.psu.edu/Admin/Get%20Galaxy WRT checking the python version: just type 'python -V' on the command line, eg on my old MacBook: bash-3.2$ python -V Python 2.5.1 bash-3.2$ Hope this helps Regards, Hans On 08/10/2012 02:37 PM, Edward Turk wrote: Hello, Could someone provide instructions for installing galaxy on a Mac OS 10.7? The instructions provided by galaxy start off by asking me to check my python version, but I don't know how to do that. I figure someone has step-by-step instructions or a screen cast? Thank you, Edward ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Install Galaxy on Mac
Hi Jen, Yes, it is best to assume I know nothing about programming. I installed Mercurial, but don't know how to check that it was successful other than it said so. Removing % helped, but said I do not have permission: Install Galaxy on Mac OS10.7 1. Open Applications/Utilities/Terminal.app 2. Check Python version by pasting in python -V, no quotes, and hit return response = Python 2.7.1 3. Install Mercurial Response = Successful Installation but I don't know how to check this 4. Get Galaxy by pasting in hg clone https://bitbucket.org/galaxy/galaxy-dist/;, no quotes, and hit return Response = warning: bitbucket.org certificate with fingerprint 24:9c:45:8b:9c:aa:ba:55:4e:01:6d:58:ff:e4:28:7d:2a:14:ae:3b not verified (check hostfingerprints or web.cacerts config setting) destination directory: galaxy-dist abort: Permission denied: /private/etc/galaxy-dist Thanks, Edward On Aug 10, 2012, at 11:36 AM, Jennifer Jackson wrote: Hi Edward - This may sound very simple, but did the % get included in the command to do the download by mistake? You'll want to remove that from the command string run again (was used to note the terminal prompt, is not a part of the command). So, just this: prompt$ hg clone https://bitbucket.org/galaxy/galaxy-dist/ I just tested the galaxy-dist repository and there are no issues at bitbucket (right now). So, otherwise the MAC install should be fine. Maybe this helps? Jen Galaxy team On 8/10/12 8:00 AM, Edward Turk wrote: Both responses worked for checking python version, but trying to download gave an error: Install Galaxy on Mac OS10.7 1. Open Applications/Utilities/Terminal.app 2. Check Python version by pasting in python -V, no quotes, and hit return *response = Python 2.7.1* 3. Get Galaxy by pasting in % hg clone https://bitbucket.org/galaxy/galaxy-dist/;, no quotes, and hit return *response = -bash: fg: %: no such job* On Aug 10, 2012, at 8:58 AM, Hotz, Hans-Rudolf wrote: Hi Edward I am moving your e-mail to 'galaxy-dev' since it's about a local Galaxy instance. I don't think there are any differences between installing Galaxy on Linux and Mac OS X. Hence you can follow the step-by-step instructions on the wiki (well, there are actually only two steps anyway...): http://wiki.g2.bx.psu.edu/Admin/Get%20Galaxy WRT checking the python version: just type 'python -V' on the command line, eg on my old MacBook: bash-3.2$ python -V Python 2.5.1 bash-3.2$ Hope this helps Regards, Hans On 08/10/2012 02:37 PM, Edward Turk wrote: Hello, Could someone provide instructions for installing galaxy on a Mac OS 10.7? The instructions provided by galaxy start off by asking me to check my python version, but I don't know how to do that. I figure someone has step-by-step instructions or a screen cast? Thank you, Edward ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ -- Jennifer Jackson http://galaxyproject.org ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Install Galaxy on Mac
I was wondering if anyone could comment on how memory/computational intensive a local instal of Galaxy is? What type of computer (especially Macs) is needed for a local install to run fairly well? Thanks for any info--- Diana ** Diana Cox-Foster, Professor office: 536 ASI Bldg MAIL: 501 ASI Bldg Department of Entomology Penn State University University Park, PA, USA 16802 email: dx...@psu.edu office phone: 814-865-1022 dept. phone: 814-865-1895 On Aug 10, 2012, at 11:36 AM, Jennifer Jackson wrote: Hi Edward - This may sound very simple, but did the % get included in the command to do the download by mistake? You'll want to remove that from the command string run again (was used to note the terminal prompt, is not a part of the command). So, just this: prompt$ hg clone https://bitbucket.org/galaxy/galaxy-dist/ I just tested the galaxy-dist repository and there are no issues at bitbucket (right now). So, otherwise the MAC install should be fine. Maybe this helps? Jen Galaxy team On 8/10/12 8:00 AM, Edward Turk wrote: Both responses worked for checking python version, but trying to download gave an error: Install Galaxy on Mac OS10.7 1. Open Applications/Utilities/Terminal.app 2. Check Python version by pasting in python -V, no quotes, and hit return *response = Python 2.7.1* 3. Get Galaxy by pasting in % hg clone https://bitbucket.org/galaxy/galaxy-dist/;, no quotes, and hit return *response = -bash: fg: %: no such job* On Aug 10, 2012, at 8:58 AM, Hotz, Hans-Rudolf wrote: Hi Edward I am moving your e-mail to 'galaxy-dev' since it's about a local Galaxy instance. I don't think there are any differences between installing Galaxy on Linux and Mac OS X. Hence you can follow the step-by-step instructions on the wiki (well, there are actually only two steps anyway...): http://wiki.g2.bx.psu.edu/Admin/Get%20Galaxy WRT checking the python version: just type 'python -V' on the command line, eg on my old MacBook: bash-3.2$ python -V Python 2.5.1 bash-3.2$ Hope this helps Regards, Hans On 08/10/2012 02:37 PM, Edward Turk wrote: Hello, Could someone provide instructions for installing galaxy on a Mac OS 10.7? The instructions provided by galaxy start off by asking me to check my python version, but I don't know how to do that. I figure someone has step-by-step instructions or a screen cast? Thank you, Edward ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ -- Jennifer Jackson http://galaxyproject.org ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Problem with running Cufflinks
Hello Yan, This workflow can be used to sort SAM input for Cufflinks: http://main.g2.bx.psu.edu/u/jeremy/p/transcriptome-analysis-faq#faq2 Best, Jen Galaxy team On 8/10/12 3:13 AM, Yan He wrote: Hi everyone, After mapping my RNA-seq data to the reference transcriptome using Bowtie, I tried to run Cufflinks, but got the following error message. It seems that I need to sort the SAM file got from Bowtie mapping. Dose anyone know how to solve this problem? Many thanks! *Error running cufflinks. return code = 1 cufflinks: /lib64/libz.so.1: no version information available (required by cufflinks) Command line: cufflinks -q --no-update-check -I 30 -F 0.10 -j 0.15 -p 8 /galaxy/main_pool/pool4/files/004/761/dataset_4761476.dat [bam_header_read] EOF marker is absent. [bam_header_read] invalid BAM binary header (this is not a BAM file). File /galaxy/main_pool/pool4/files/004/761/dataset_4761476.dat doesn't appear to be a valid BAM file, trying SAM... [03:31:18] Inspecting reads and determining fragment length distribution. Error: this SAM file doesn't appear to be correctly sorted! current hit is at CGI_10025607:534, last one was at CGI_10021217:812 Cufflinks requires that if your file has SQ records in the SAM header that they appear in the same order as the chromosomes names in the alignments. If there are no SQ records in the header, or if the header is missing, the alignments must be sorted lexicographically by chromsome name and by position.* Yan ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ -- Jennifer Jackson http://galaxyproject.org ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] reference genome format for tophat
Hello Irene, This wiki has the formatting details, including a screencast for genome prep, and many tips for correcting format problems that use Galaxy's tools whenever possible: http://wiki.g2.bx.psu.edu/Learn/CustomGenomes#Screencasts_.26_Tutorials watch Custom Genome Prep http://wiki.g2.bx.psu.edu/Learn/CustomGenomes#Troubleshooting That said, it many simply be that the datatype is not actually set to be fasta for the dataset? Do this by clicking on the pencil icon to reach the Edit Attributes form, set this manually, and save. Hopefully this helps, Jen Galaxy team On 8/10/12 3:39 AM, i b wrote: Dear all, I managed to upload to Galaxy a genome of interest in .fasta format from NCIB website. However, Galaxy does not recognize it as input to run Tophat... Wht format has to be to be used as referece genome for tophat?and how can i convert it? Any suggestion? thanks, ib ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ -- Jennifer Jackson http://galaxyproject.org ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Install Galaxy on Mac
Hi Edward, Sorry, the https is probably also a problem. I thought about commenting about that before, but was wasn't sure about how much help you would need exactly or if you were logged into bitbucket or not. So please use this: prompt$ hg clone http://bitbucket.org/galaxy/galaxy-dist If you ever need to clone again or update, the commands are in the News Brief summaries + top of each full report: http://wiki.g2.bx.psu.edu/DevNewsBriefs ** Note the % is used here to designate the terminal prompt. This is fairly common, so now that you know, you will be able to recognize it. Also look for the $ and characters to represent the prompt at the start of a shared command line in various documents (Galaxy or other). I'll just use prompt$ right now to be clear. For Mercurial, to confirm the install, you can type at the terminal prompt from anywhere: prompt$ hg version prompt$ hg help The quick start and guide at http://mercurial.selenic.com/ is a good place for basic hg commands. A web search will return plenty of other choices. This is the last email in this thread I think we should send to both lists - from here forward let's just cc to galaxy-...@bx.psu.edu for follow-up and leave the user list off - no need to post to both. The other question about MAC resource we can do the same with, once answered. Best, Jen Galaxy team On 8/10/12 8:53 AM, Edward Turk wrote: Hi Jen, Yes, it is best to assume I know nothing about programming. I installed Mercurial, but don't know how to check that it was successful other than it said so. Removing % helped, but said I do not have permission: Install Galaxy on Mac OS10.7 1. Open Applications/Utilities/Terminal.app 2. Check Python version by pasting in python -V, no quotes, and hit return *response = Python 2.7.1* 3. Install Mercurial *Response = Successful Installation but I don't know how to check this * 4. Get Galaxy by pasting in hg clone https://bitbucket.org/galaxy/galaxy-dist/;, no quotes, and hit return *Response = warning: bitbucket.org http://bitbucket.org certificate with fingerprint 24:9c:45:8b:9c:aa:ba:55:4e:01:6d:58:ff:e4:28:7d:2a:14:ae:3b not verified (check hostfingerprints or web.cacerts config setting)* *destination directory: galaxy-dist* *abort: Permission denied: /private/etc/galaxy-dist* Thanks, Edward On Aug 10, 2012, at 11:36 AM, Jennifer Jackson wrote: Hi Edward - This may sound very simple, but did the % get included in the command to do the download by mistake? You'll want to remove that from the command string run again (was used to note the terminal prompt, is not a part of the command). So, just this: prompt$ hg clone https://bitbucket.org/galaxy/galaxy-dist/ I just tested the galaxy-dist repository and there are no issues at bitbucket (right now). So, otherwise the MAC install should be fine. Maybe this helps? Jen Galaxy team On 8/10/12 8:00 AM, Edward Turk wrote: Both responses worked for checking python version, but trying to download gave an error: Install Galaxy on Mac OS10.7 1. Open Applications/Utilities/Terminal.app 2. Check Python version by pasting in python -V, no quotes, and hit return *response = Python 2.7.1* 3. Get Galaxy by pasting in % hg clone https://bitbucket.org/galaxy/galaxy-dist/;, no quotes, and hit return *response = -bash: fg: %: no such job* On Aug 10, 2012, at 8:58 AM, Hotz, Hans-Rudolf wrote: Hi Edward I am moving your e-mail to 'galaxy-dev' since it's about a local Galaxy instance. I don't think there are any differences between installing Galaxy on Linux and Mac OS X. Hence you can follow the step-by-step instructions on the wiki (well, there are actually only two steps anyway...): http://wiki.g2.bx.psu.edu/Admin/Get%20Galaxy WRT checking the python version: just type 'python -V' on the command line, eg on my old MacBook: bash-3.2$ python -V Python 2.5.1 bash-3.2$ Hope this helps Regards, Hans On 08/10/2012 02:37 PM, Edward Turk wrote: Hello, Could someone provide instructions for installing galaxy on a Mac OS 10.7? The instructions provided by galaxy start off by asking me to check my python version, but I don't know how to do that. I figure someone has step-by-step instructions or a screen cast? Thank you, Edward ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org http://usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at
Re: [galaxy-user] Install Galaxy on Mac
Thanks Jen, Hans, and Scott, I have it running on my laptop now and here are the steps I followed: Install Galaxy on MacBook Pro OS10.7.4 (08-10-2012) • Install Mercurial http://mercurial.selenic.com/wiki/ • Open Applications/Utilities/Terminal.app • Confirm Mercurial installation by pasting in hg version, no quotes and hit return response = version 2.3+20120807 • Check Python version by pasting in python -V, no quotes and hit return response = Python 2.7.1 • Go to your home directory by pasting in cd, no quotes and hit return • Get Galaxy by pasting in hg clone http://bitbucket.org/galaxy/galaxy-dist/;, no quotes and hit return • Go to the Galaxy directory by pasting in cd galaxy-dist, no quotes and hit return • Start up Galaxy by pasting in sh run.sh, no quotes and hit return • Open web browser and paste in “http://localhost:8080”, no quotes and hit return Have a nice day, Edward On Aug 10, 2012, at 1:41 PM, Jennifer Jackson wrote: Update (and a post to both lists!) Nate pointed me to the real problem. https/http isn't a problem at bitbucket anymore. The issue is where you are installing (/etc) and write permissions. But, it is not recommended anyway. You will want to install in your home directory. To get there, type: prompt$ cd Just that will put you in your home. To see where this is on your system path, type this: prompt$ pwd To see what else is here, type: prompt$ ls A google for mac unix commands will bring up various basic help/tutorials and such as you need them. Hopefully this gets you going! Jen Galaxy team On 8/10/12 9:59 AM, Jennifer Jackson wrote: Hi Edward, Sorry, the https is probably also a problem. I thought about commenting about that before, but was wasn't sure about how much help you would need exactly or if you were logged into bitbucket or not. So please use this: prompt$ hg clone http://bitbucket.org/galaxy/galaxy-dist If you ever need to clone again or update, the commands are in the News Brief summaries + top of each full report: http://wiki.g2.bx.psu.edu/DevNewsBriefs ** Note the % is used here to designate the terminal prompt. This is fairly common, so now that you know, you will be able to recognize it. Also look for the $ and characters to represent the prompt at the start of a shared command line in various documents (Galaxy or other). I'll just use prompt$ right now to be clear. For Mercurial, to confirm the install, you can type at the terminal prompt from anywhere: prompt$ hg version prompt$ hg help The quick start and guide at http://mercurial.selenic.com/ is a good place for basic hg commands. A web search will return plenty of other choices. This is the last email in this thread I think we should send to both lists - from here forward let's just cc to galaxy-...@bx.psu.edu for follow-up and leave the user list off - no need to post to both. The other question about MAC resource we can do the same with, once answered. Best, Jen Galaxy team On 8/10/12 8:53 AM, Edward Turk wrote: Hi Jen, Yes, it is best to assume I know nothing about programming. I installed Mercurial, but don't know how to check that it was successful other than it said so. Removing % helped, but said I do not have permission: Install Galaxy on Mac OS10.7 1. Open Applications/Utilities/Terminal.app 2. Check Python version by pasting in python -V, no quotes, and hit return *response = Python 2.7.1* 3. Install Mercurial *Response = Successful Installation but I don't know how to check this * 4. Get Galaxy by pasting in hg clone https://bitbucket.org/galaxy/galaxy-dist/;, no quotes, and hit return *Response = warning: bitbucket.org http://bitbucket.org certificate with fingerprint 24:9c:45:8b:9c:aa:ba:55:4e:01:6d:58:ff:e4:28:7d:2a:14:ae:3b not verified (check hostfingerprints or web.cacerts config setting)* *destination directory: galaxy-dist* *abort: Permission denied: /private/etc/galaxy-dist* Thanks, Edward On Aug 10, 2012, at 11:36 AM, Jennifer Jackson wrote: Hi Edward - This may sound very simple, but did the % get included in the command to do the download by mistake? You'll want to remove that from the command string run again (was used to note the terminal prompt, is not a part of the command). So, just this: prompt$ hg clone https://bitbucket.org/galaxy/galaxy-dist/ I just tested the galaxy-dist repository and there are no issues at bitbucket (right now). So, otherwise the MAC install should be fine. Maybe this helps? Jen Galaxy team On 8/10/12 8:00 AM, Edward Turk wrote: Both responses worked for checking python version, but trying to download gave an error: Install Galaxy on Mac OS10.7 1. Open Applications/Utilities/Terminal.app 2. Check Python version by pasting in python -V, no quotes, and hit
[galaxy-user] (no subject)
I am new to the NGS analysis. I need help to solve this problem. As shown in my previous emial/question shown below, I have some paired-end datasets at FASTQ format, and I have problem to split each of these datasets into two datasets (one forward and one reverse). Jennifer instructed me to assign the datatype to be fastqsanger first and then run 'Manipulate FASTQ'. I have two questions: 1) Now that the datasets were already split into forward and reverse reads when extracted in FASTQ format from the SRA, can I use them just as single end data? 2) If I do need to split each dataset into two datasets, how should I choose the settings when I run Manipulte FASTQ? Thanks. Jianguang / On 8/10/12 7:21 AM, Du, Jianguang wrote: I have problem to split a paired-end FASTQ dataset into two separate datasets. In order to explain the problem clearly, I list the detail of what I did with my dataset: Step 1) My aim is to compare datasets for the differential alternative splicing. I downloaded paired-end datasets at FASTQ format from SRA of NCBI as original data. Below is part of my paired-end FASTQ dataset that I downloaed from SRA of NCBI, Does this dataset look OK? @SRR192532.1.1 HWI-EAS269:1:4:655:110.1 length=35 GCTGAGTGAGGGTGTGTTTGGAGTTTG +SRR192532.1.1 HWI-EAS269:1:4:655:110.1 length=35 I28II;II*2/5:++,(..*943F@I.('+.35' @SRR192532.1.2 HWI-EAS269:1:4:655:110.2 length=35 AAAGATGTTAGTGATACGGAAAGGATATCTC +SRR192532.1.2 HWI-EAS269:1:4:655:110.2 length=35 9+*9+7@?F1206,IGI+D122/0++-.+6/@? Step 2) Then I performed FASTQ groomer at setting as follows: a) Input FASTQ quality scores type: Illumina 1.3-1.7 b)Advanced Options: Hide Advanced Options. Did I choose the right setting for FASTQ groomer? Should I use Advanced Options? If yes, what is the setting for Advances Options? Below is part of groomed dataset: @SRR192532.1.1 HWI-EAS269:1:4:655:110.1 length=35 GCTGAGTGAGGGTGTGTTTGGAGTTTG +SRR192532.1.1 HWI-EAS269:1:4:655:110.1 length=35 *!!**!**'!* @SRR192532.1.2 HWI-EAS269:1:4:655:110.2 length=35 AAAGATGTTAGTGATACGGAAAGGATATCTC +SRR192532.1.2 HWI-EAS269:1:4:655:110.2 length=35 '!*(*!% Does the groomed data look right? Is number represnting the member of a pair correct? Here they are .1 and .2, should they be /1 and /2? Step 3) Then I ran FASTQ splitter with the groomed files. There is not setting for the splitter. I chose the right groomed file and then click Excute. Below is the description of the splitted dataset: empty format:fastqsanger, database:hg19 Info: Split 0 of 15277248 reads (0.00%). Please help me dela with this problem. Thanks. Jianguang Du ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
[galaxy-user] need help to split paired-end dataset
I am new to the NGS analysis. I need help to solve this problem. As shown in my previous emial/question shown below, I have some paired-end datasets at FASTQ format, and I have problem to split each of these datasets into two datasets (one forward and one reverse). Jennifer instructed me to assign the datatype to be fastqsanger first and then run 'Manipulate FASTQ'. I have two questions: 1) Now that the datasets were already split into forward and reverse reads when extracted in FASTQ format from the SRA, can I use them just as single end data? 2) If I do need to split each dataset into two datasets, how should I choose the settings when I run Manipulte FASTQ? Thanks. Jianguang / On 8/10/12 7:21 AM, Du, Jianguang wrote: I have problem to split a paired-end FASTQ dataset into two separate datasets. In order to explain the problem clearly, I list the detail of what I did with my dataset: Step 1) My aim is to compare datasets for the differential alternative splicing. I downloaded paired-end datasets at FASTQ format from SRA of NCBI as original data. Below is part of my paired-end FASTQ dataset that I downloaed from SRA of NCBI, Does this dataset look OK? @SRR192532.1.1 HWI-EAS269:1:4:655:110.1 length=35 GCTGAGTGAGGGTGTGTTTGGAGTTTG +SRR192532.1.1 HWI-EAS269:1:4:655:110.1 length=35 I28II;II*2/5:++,(..*943F@I.('+.35' @SRR192532.1.2 HWI-EAS269:1:4:655:110.2 length=35 AAAGATGTTAGTGATACGGAAAGGATATCTC +SRR192532.1.2 HWI-EAS269:1:4:655:110.2 length=35 9+*9+7@?F1206,IGI+D122/0++-.+6/@? Step 2) Then I performed FASTQ groomer at setting as follows: a) Input FASTQ quality scores type: Illumina 1.3-1.7 b)Advanced Options: Hide Advanced Options. Did I choose the right setting for FASTQ groomer? Should I use Advanced Options? If yes, what is the setting for Advances Options? Below is part of groomed dataset: @SRR192532.1.1 HWI-EAS269:1:4:655:110.1 length=35 GCTGAGTGAGGGTGTGTTTGGAGTTTG +SRR192532.1.1 HWI-EAS269:1:4:655:110.1 length=35 *!!**!**'!* @SRR192532.1.2 HWI-EAS269:1:4:655:110.2 length=35 AAAGATGTTAGTGATACGGAAAGGATATCTC +SRR192532.1.2 HWI-EAS269:1:4:655:110.2 length=35 '!*(*!% Does the groomed data look right? Is number represnting the member of a pair correct? Here they are .1 and .2, should they be /1 and /2? Step 3) Then I ran FASTQ splitter with the groomed files. There is not setting for the splitter. I chose the right groomed file and then click Excute. Below is the description of the splitted dataset: empty format:fastqsanger, database:hg19 Info: Split 0 of 15277248 reads (0.00%). Please help me dela with this problem. Thanks. Jianguang Du ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Install Galaxy on Mac
Hello Ted, Workflows are included in the Galaxy Main Tool Shed http://toolshed.g2.bx.psu.edu/ -- Search for workflows Documentation is in this wiki (see #22, 23, 24): http://wiki.g2.bx.psu.edu/Tool%20Shed Other current information about workflow development can be found in the meeting notes from the 2012 GCC Breakout. http://wiki.g2.bx.psu.edu/Events/GCC2012/Program/Breakouts/WorkflowsAndAPI Best, Jen Galaxy team On 8/10/12 1:31 PM, Ted Goldstein wrote: Hi Jen, I know we are using Mercurial for Galaxy's own source code. Is there a way for Galaxy to store and retrieve workflows from Mercurial? Thanks, Ted UCSC CBSE On Aug 10, 2012, at 1:06 PM, Jennifer Jackson wrote: Hi Diana, Galaxy itself will run on any recent MAC with the basic requirements (python, mercurial, etc.). The standard set-up isn't computationally intensive at all. What makes a difference are the tools you intend to use, the size of the data (genomes, datasets, libraries), the volume of throughput, and processing speed expectations. This wiki has some general guidelines that can help you decide between how to use Galaxy (Main, Local, or Cloud) based on these and related factors: http://wiki.g2.bx.psu.edu/Big%20Picture/Choices But what would be best, to address your specific question, is if you could provide more information about what you intend to do. Others on the mailing list would likely be able to comment about what type of set-up they are using successfully for similar work. Best, Jen Galaxy team On 8/10/12 8:53 AM, Diana Cox-Foster wrote: I was wondering if anyone could comment on how memory/computational intensive a local instal of Galaxy is? What type of computer (especially Macs) is needed for a local install to run fairly well? Thanks for any info--- Diana ** Diana Cox-Foster, Professor office: 536 ASI Bldg MAIL: 501 ASI Bldg Department of Entomology Penn State University University Park, PA, USA 16802 email: dx...@psu.edu office phone: 814-865-1022 dept. phone: 814-865-1895 -- Jennifer Jackson http://galaxyproject.org ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ -- Jennifer Jackson http://galaxyproject.org ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
[galaxy-user] Extracting all CpG-SNPs from dbSNP135
Dear Sir / Madam, I'm new to Galaxy. Is there any way to extract all CpG-SNPs from dbSNP135 using Galaxy (preferably as a BED file, but a text file will do)? I tried to figure out myself, but came up short... All help is much appreciated! Sincerely, RH ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Install Galaxy on Mac
Hi Edward I am moving your e-mail to 'galaxy-dev' since it's about a local Galaxy instance. I don't think there are any differences between installing Galaxy on Linux and Mac OS X. Hence you can follow the step-by-step instructions on the wiki (well, there are actually only two steps anyway...): http://wiki.g2.bx.psu.edu/Admin/Get%20Galaxy WRT checking the python version: just type 'python -V' on the command line, eg on my old MacBook: bash-3.2$ python -V Python 2.5.1 bash-3.2$ Hope this helps Regards, Hans On 08/10/2012 02:37 PM, Edward Turk wrote: Hello, Could someone provide instructions for installing galaxy on a Mac OS 10.7? The instructions provided by galaxy start off by asking me to check my python version, but I don't know how to do that. I figure someone has step-by-step instructions or a screen cast? Thank you, Edward ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/