[galaxy-user] cuffcompare inputs

2012-08-10 Thread i b
Dear all,
given 3 samples, 1 control and 2 treated replicates when I do
cuffcompare to produce the gtf input for cuffdiff, do I have to run it
with or without the cufflink control?
E.g. Cuffcompare with only my 2 treated replicates?--use
this gtf to run cuffdiff
   Cuffcompare 1 contro and 2 treated replicates?--use
this gtf to run cuffdff

Thanks a lot
ib
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using reply all in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/


[galaxy-user] reference genome format for tophat

2012-08-10 Thread i b
Dear all,
I managed to upload to Galaxy a genome of interest in .fasta format
from NCIB website.

However, Galaxy does not recognize it as input to run Tophat...

Wht format has to be to be used as referece genome for tophat?and how
can i convert it?

Any suggestion?

thanks,
ib
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using reply all in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/


[galaxy-user] Install Galaxy on Mac

2012-08-10 Thread Edward Turk
Hello,
Could someone provide instructions for installing galaxy on a Mac OS 10.7? The 
instructions provided by galaxy start off by asking me to check my python 
version, but I don't know how to do that. I figure someone has step-by-step 
instructions or a screen cast?
Thank you,
Edward
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using reply all in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/


[galaxy-user] FASTQ splitter produced empty dataset, please help

2012-08-10 Thread Du, Jianguang
I have problem to split a paired-end FASTQ dataset into two separate datasets. 
In order to explain the problem clearly, I list the detail of what I did with 
my dataset:



Step 1) My aim is to compare datasets for the differential alternative 
splicing. I downloaded paired-end datasets at FASTQ format from SRA of NCBI as 
original data.



Below is part of my paired-end FASTQ dataset that I downloaed from SRA of NCBI, 
Does this dataset look OK?

@SRR192532.1.1 HWI-EAS269:1:4:655:110.1 length=35
GCTGAGTGAGGGTGTGTTTGGAGTTTG
+SRR192532.1.1 HWI-EAS269:1:4:655:110.1 length=35
I28II;II*2/5:++,(..*943F@I.('+.35'
@SRR192532.1.2 HWI-EAS269:1:4:655:110.2 length=35
AAAGATGTTAGTGATACGGAAAGGATATCTC
+SRR192532.1.2 HWI-EAS269:1:4:655:110.2 length=35
9+*9+7@?F1206,IGI+D122/0++-.+6/@?

Step 2) Then I performed FASTQ groomer at setting as follows:



a) Input FASTQ quality scores type: Illumina 1.3-1.7

b)Advanced Options: Hide Advanced Options.



Did I choose the right setting for FASTQ groomer? Should I use Advanced 
Options? If yes, what is the setting for Advances Options?



Below is part of groomed dataset:

@SRR192532.1.1 HWI-EAS269:1:4:655:110.1 length=35
GCTGAGTGAGGGTGTGTTTGGAGTTTG
+SRR192532.1.1 HWI-EAS269:1:4:655:110.1 length=35
*!!**!**'!*
@SRR192532.1.2 HWI-EAS269:1:4:655:110.2 length=35
AAAGATGTTAGTGATACGGAAAGGATATCTC
+SRR192532.1.2 HWI-EAS269:1:4:655:110.2 length=35
'!*(*!%

Does the groomed data look right? Is number represnting the member of a pair 
correct? Here they are .1 and .2, should they be /1 and /2?



Step 3) Then I ran FASTQ splitter with the groomed files. There is not setting 
for the splitter. I chose the right groomed file and then click Excute. Below 
is the description of the splitted dataset:



empty
format: fastqsanger, database:hg19
Info: Split 0 of 15277248 reads (0.00%).



Please help me dela with this problem.

Thanks.

Jianguang Du








___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using reply all in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

Re: [galaxy-user] Install Galaxy on Mac

2012-08-10 Thread Edward Turk
Both responses worked for checking python version, but trying to download gave 
an error:

Install Galaxy on Mac OS10.7
1. Open Applications/Utilities/Terminal.app
2. Check Python version by pasting in python -V, no quotes, and hit return
response = Python 2.7.1
3. Get Galaxy by pasting in % hg clone 
https://bitbucket.org/galaxy/galaxy-dist/;, no quotes, and hit return 
response = -bash: fg: %: no such job
On Aug 10, 2012, at 8:58 AM, Hotz, Hans-Rudolf wrote:

 Hi Edward
 
 I am moving your e-mail to 'galaxy-dev' since it's about a local Galaxy
 instance.
 
 I don't think there are any differences between installing Galaxy on
 Linux and Mac OS X. Hence you can follow the step-by-step instructions
 on the wiki (well, there are actually only two steps anyway...):
 
 http://wiki.g2.bx.psu.edu/Admin/Get%20Galaxy
 
 
 WRT checking the python version:
 
 just type 'python -V' on the command line, eg on my old MacBook:
 
 bash-3.2$ python -V
 Python 2.5.1
 bash-3.2$
 
 
 Hope this helps
 Regards, Hans
 
 
 
 On 08/10/2012 02:37 PM, Edward Turk wrote:
 Hello,
 Could someone provide instructions for installing galaxy on a Mac OS 10.7? 
 The
 instructions provided by galaxy start off by asking me to check my python
 version, but I don't know how to do that. I figure someone has step-by-step
 instructions or a screen cast?
 Thank you,
 Edward
 ___
 The Galaxy User list should be used for the discussion of
 Galaxy analysis and other features on the public server
 at usegalaxy.org.  Please keep all replies on the list by
 using reply all in your mail client.  For discussion of
 local Galaxy instances and the Galaxy source code, please
 use the Galaxy Development list:
 
   http://lists.bx.psu.edu/listinfo/galaxy-dev
 
 To manage your subscriptions to this and other Galaxy lists,
 please use the interface at:
 
   http://lists.bx.psu.edu/
 
 

___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using reply all in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

Re: [galaxy-user] Install Galaxy on Mac

2012-08-10 Thread Edward Turk
Hi Jen,

Yes, it is best to assume I know nothing about programming. I installed 
Mercurial, but don't know how to check that it was successful other than it 
said so. Removing % helped, but said I do not have permission:

Install Galaxy on Mac OS10.7
1. Open Applications/Utilities/Terminal.app
2. Check Python version by pasting in python -V, no quotes, and hit return
response = Python 2.7.1
3. Install Mercurial
Response = Successful Installation but I don't know how to check this 
4. Get Galaxy by pasting in hg clone 
https://bitbucket.org/galaxy/galaxy-dist/;, no quotes, and hit return 
Response = warning: bitbucket.org certificate with fingerprint 
24:9c:45:8b:9c:aa:ba:55:4e:01:6d:58:ff:e4:28:7d:2a:14:ae:3b not verified (check 
hostfingerprints or web.cacerts config setting)
destination directory: galaxy-dist
abort: Permission denied: /private/etc/galaxy-dist

Thanks,
Edward
On Aug 10, 2012, at 11:36 AM, Jennifer Jackson wrote:

 Hi Edward -
 
 This may sound very simple, but did the % get included in the command to do 
 the download by mistake? You'll want to remove that from the command string 
 run again (was used to note the terminal prompt, is not a part of the 
 command). So, just this:
 
 prompt$  hg clone https://bitbucket.org/galaxy/galaxy-dist/
 
 I just tested the galaxy-dist repository and there are no issues at bitbucket 
 (right now). So, otherwise the MAC install should be fine.
 
 Maybe this helps?
 
 Jen
 Galaxy team
 
 On 8/10/12 8:00 AM, Edward Turk wrote:
 Both responses worked for checking python version, but trying to
 download gave an error:
 
 Install Galaxy on Mac OS10.7
 1. Open Applications/Utilities/Terminal.app
 2. Check Python version by pasting in python -V, no quotes, and hit return
 *response = Python 2.7.1*
 3. Get Galaxy by pasting in % hg clone
 https://bitbucket.org/galaxy/galaxy-dist/;, no quotes, and hit return
 *response = -bash: fg: %: no such job*
 On Aug 10, 2012, at 8:58 AM, Hotz, Hans-Rudolf wrote:
 
 Hi Edward
 
 I am moving your e-mail to 'galaxy-dev' since it's about a local Galaxy
 instance.
 
 I don't think there are any differences between installing Galaxy on
 Linux and Mac OS X. Hence you can follow the step-by-step instructions
 on the wiki (well, there are actually only two steps anyway...):
 
 http://wiki.g2.bx.psu.edu/Admin/Get%20Galaxy
 
 
 WRT checking the python version:
 
 just type 'python -V' on the command line, eg on my old MacBook:
 
 bash-3.2$ python -V
 Python 2.5.1
 bash-3.2$
 
 
 Hope this helps
 Regards, Hans
 
 
 
 On 08/10/2012 02:37 PM, Edward Turk wrote:
 Hello,
 Could someone provide instructions for installing galaxy on a Mac OS
 10.7? The
 instructions provided by galaxy start off by asking me to check my python
 version, but I don't know how to do that. I figure someone has
 step-by-step
 instructions or a screen cast?
 Thank you,
 Edward
 ___
 The Galaxy User list should be used for the discussion of
 Galaxy analysis and other features on the public server
 at usegalaxy.org.  Please keep all replies on the list by
 using reply all in your mail client.  For discussion of
 local Galaxy instances and the Galaxy source code, please
 use the Galaxy Development list:
 
  http://lists.bx.psu.edu/listinfo/galaxy-dev
 
 To manage your subscriptions to this and other Galaxy lists,
 please use the interface at:
 
  http://lists.bx.psu.edu/
 
 
 
 
 
 ___
 The Galaxy User list should be used for the discussion of
 Galaxy analysis and other features on the public server
 at usegalaxy.org.  Please keep all replies on the list by
 using reply all in your mail client.  For discussion of
 local Galaxy instances and the Galaxy source code, please
 use the Galaxy Development list:
 
   http://lists.bx.psu.edu/listinfo/galaxy-dev
 
 To manage your subscriptions to this and other Galaxy lists,
 please use the interface at:
 
   http://lists.bx.psu.edu/
 
 
 -- 
 Jennifer Jackson
 http://galaxyproject.org

___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using reply all in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

Re: [galaxy-user] Install Galaxy on Mac

2012-08-10 Thread Diana Cox-Foster
I was wondering if anyone could comment on how memory/computational intensive a 
local instal of Galaxy is?  What type of computer (especially Macs) is needed 
for a local install to run fairly well?

Thanks for any info--- Diana
**
Diana Cox-Foster, Professor
office: 536 ASI Bldg

MAIL:
501 ASI Bldg
Department of Entomology
Penn State University
University Park, PA, USA 16802

email: dx...@psu.edu
office phone: 814-865-1022
dept. phone: 814-865-1895



On Aug 10, 2012, at 11:36 AM, Jennifer Jackson wrote:

 Hi Edward -
 
 This may sound very simple, but did the % get included in the command to do 
 the download by mistake? You'll want to remove that from the command string 
 run again (was used to note the terminal prompt, is not a part of the 
 command). So, just this:
 
 prompt$  hg clone https://bitbucket.org/galaxy/galaxy-dist/
 
 I just tested the galaxy-dist repository and there are no issues at bitbucket 
 (right now). So, otherwise the MAC install should be fine.
 
 Maybe this helps?
 
 Jen
 Galaxy team
 
 On 8/10/12 8:00 AM, Edward Turk wrote:
 Both responses worked for checking python version, but trying to
 download gave an error:
 
 Install Galaxy on Mac OS10.7
 1. Open Applications/Utilities/Terminal.app
 2. Check Python version by pasting in python -V, no quotes, and hit return
 *response = Python 2.7.1*
 3. Get Galaxy by pasting in % hg clone
 https://bitbucket.org/galaxy/galaxy-dist/;, no quotes, and hit return
 *response = -bash: fg: %: no such job*
 On Aug 10, 2012, at 8:58 AM, Hotz, Hans-Rudolf wrote:
 
 Hi Edward
 
 I am moving your e-mail to 'galaxy-dev' since it's about a local Galaxy
 instance.
 
 I don't think there are any differences between installing Galaxy on
 Linux and Mac OS X. Hence you can follow the step-by-step instructions
 on the wiki (well, there are actually only two steps anyway...):
 
 http://wiki.g2.bx.psu.edu/Admin/Get%20Galaxy
 
 
 WRT checking the python version:
 
 just type 'python -V' on the command line, eg on my old MacBook:
 
 bash-3.2$ python -V
 Python 2.5.1
 bash-3.2$
 
 
 Hope this helps
 Regards, Hans
 
 
 
 On 08/10/2012 02:37 PM, Edward Turk wrote:
 Hello,
 Could someone provide instructions for installing galaxy on a Mac OS
 10.7? The
 instructions provided by galaxy start off by asking me to check my python
 version, but I don't know how to do that. I figure someone has
 step-by-step
 instructions or a screen cast?
 Thank you,
 Edward
 ___
 The Galaxy User list should be used for the discussion of
 Galaxy analysis and other features on the public server
 at usegalaxy.org.  Please keep all replies on the list by
 using reply all in your mail client.  For discussion of
 local Galaxy instances and the Galaxy source code, please
 use the Galaxy Development list:
 
  http://lists.bx.psu.edu/listinfo/galaxy-dev
 
 To manage your subscriptions to this and other Galaxy lists,
 please use the interface at:
 
  http://lists.bx.psu.edu/
 
 
 
 
 
 ___
 The Galaxy User list should be used for the discussion of
 Galaxy analysis and other features on the public server
 at usegalaxy.org.  Please keep all replies on the list by
 using reply all in your mail client.  For discussion of
 local Galaxy instances and the Galaxy source code, please
 use the Galaxy Development list:
 
   http://lists.bx.psu.edu/listinfo/galaxy-dev
 
 To manage your subscriptions to this and other Galaxy lists,
 please use the interface at:
 
   http://lists.bx.psu.edu/
 
 
 -- 
 Jennifer Jackson
 http://galaxyproject.org
 ___
 The Galaxy User list should be used for the discussion of
 Galaxy analysis and other features on the public server
 at usegalaxy.org.  Please keep all replies on the list by
 using reply all in your mail client.  For discussion of
 local Galaxy instances and the Galaxy source code, please
 use the Galaxy Development list:
 
 http://lists.bx.psu.edu/listinfo/galaxy-dev
 
 To manage your subscriptions to this and other Galaxy lists,
 please use the interface at:
 
 http://lists.bx.psu.edu/


___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using reply all in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/


Re: [galaxy-user] Problem with running Cufflinks

2012-08-10 Thread Jennifer Jackson

Hello Yan,

This workflow can be used to sort SAM input for Cufflinks:
http://main.g2.bx.psu.edu/u/jeremy/p/transcriptome-analysis-faq#faq2

Best,

Jen
Galaxy team

On 8/10/12 3:13 AM, Yan He wrote:


Hi everyone,

After mapping my RNA-seq data to the reference transcriptome using Bowtie, I 
tried to run Cufflinks, but got the following error message. It seems that I 
need to sort the SAM file got from Bowtie mapping. Dose anyone know how to 
solve this problem? Many thanks!


*Error running cufflinks.
return code = 1
cufflinks: /lib64/libz.so.1: no version information available (required by 
cufflinks)
Command line:
cufflinks -q --no-update-check -I 30 -F 0.10 -j 0.15 -p 8 
/galaxy/main_pool/pool4/files/004/761/dataset_4761476.dat
[bam_header_read] EOF marker is absent.
[bam_header_read] invalid BAM binary header (this is not a BAM file).
File /galaxy/main_pool/pool4/files/004/761/dataset_4761476.dat doesn't appear 
to be a valid BAM file, trying SAM...
[03:31:18] Inspecting reads and determining fragment length distribution.

Error: this SAM file doesn't appear to be correctly sorted!
current hit is at CGI_10025607:534, last one was at CGI_10021217:812
Cufflinks requires that if your file has SQ records in
the SAM header that they appear in the same order as the chromosomes names
in the alignments.
If there are no SQ records in the header, or if the header is missing,
the alignments must be sorted lexicographically by chromsome
name and by position.*



Yan



___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using reply all in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

   http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

   http://lists.bx.psu.edu/



--
Jennifer Jackson
http://galaxyproject.org
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using reply all in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

 http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

 http://lists.bx.psu.edu/


Re: [galaxy-user] reference genome format for tophat

2012-08-10 Thread Jennifer Jackson

Hello Irene,

This wiki has the formatting details, including a screencast for genome 
prep, and many tips for correcting format problems that use Galaxy's 
tools whenever possible:


http://wiki.g2.bx.psu.edu/Learn/CustomGenomes#Screencasts_.26_Tutorials
watch Custom Genome Prep

http://wiki.g2.bx.psu.edu/Learn/CustomGenomes#Troubleshooting

That said, it many simply be that the datatype is not actually set to 
be fasta for the dataset? Do this by clicking on the pencil icon to 
reach the Edit Attributes form, set this manually, and save.


Hopefully this helps,

Jen
Galaxy team

On 8/10/12 3:39 AM, i b wrote:

Dear all,
I managed to upload to Galaxy a genome of interest in .fasta format
from NCIB website.

However, Galaxy does not recognize it as input to run Tophat...

Wht format has to be to be used as referece genome for tophat?and how
can i convert it?

Any suggestion?

thanks,
ib
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using reply all in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

   http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

   http://lists.bx.psu.edu/



--
Jennifer Jackson
http://galaxyproject.org
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using reply all in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

 http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

 http://lists.bx.psu.edu/


Re: [galaxy-user] Install Galaxy on Mac

2012-08-10 Thread Jennifer Jackson

Hi Edward,

Sorry, the https is probably also a problem. I thought about 
commenting about that before, but was wasn't sure about how much help 
you would need exactly or if you were logged into bitbucket or not. So 
please use this:


  prompt$ hg clone http://bitbucket.org/galaxy/galaxy-dist

If you ever need to clone again or update, the commands are in the News 
Brief summaries + top of each full report:

http://wiki.g2.bx.psu.edu/DevNewsBriefs

** Note the % is used here to designate the terminal prompt. This is 
fairly common, so now that you know, you will be able to recognize it. 
Also look for the $ and  characters to represent the prompt at the 
start of a shared command line in various documents (Galaxy or other). 
I'll just use prompt$ right now to be clear.


For Mercurial, to confirm the install, you can type at the terminal 
prompt from anywhere:


   prompt$ hg version
   prompt$ hg help

The quick start and guide at http://mercurial.selenic.com/ is a good 
place for basic hg commands. A web search will return plenty of other 
choices.


This is the last email in this thread I think we should send to both 
lists - from here forward let's just cc to galaxy-...@bx.psu.edu for 
follow-up and leave the user list off - no need to post to both. The 
other question about MAC resource we can do the same with, once answered.


Best,

Jen
Galaxy team

On 8/10/12 8:53 AM, Edward Turk wrote:

Hi Jen,

Yes, it is best to assume I know nothing about programming. I installed
Mercurial, but don't know how to check that it was successful other than
it said so. Removing % helped, but said I do not have permission:

Install Galaxy on Mac OS10.7
1. Open Applications/Utilities/Terminal.app
2. Check Python version by pasting in python -V, no quotes, and hit return
*response = Python 2.7.1*
3. Install Mercurial
*Response = Successful Installation but I don't know how to check this *
4. Get Galaxy by pasting in hg clone
https://bitbucket.org/galaxy/galaxy-dist/;, no quotes, and hit return
*Response = warning: bitbucket.org http://bitbucket.org certificate
with fingerprint
24:9c:45:8b:9c:aa:ba:55:4e:01:6d:58:ff:e4:28:7d:2a:14:ae:3b not verified
(check hostfingerprints or web.cacerts config setting)*
*destination directory: galaxy-dist*
*abort: Permission denied: /private/etc/galaxy-dist*

Thanks,
Edward
On Aug 10, 2012, at 11:36 AM, Jennifer Jackson wrote:


Hi Edward -

This may sound very simple, but did the % get included in the
command to do the download by mistake? You'll want to remove that from
the command string run again (was used to note the terminal prompt, is
not a part of the command). So, just this:

prompt$  hg clone https://bitbucket.org/galaxy/galaxy-dist/

I just tested the galaxy-dist repository and there are no issues at
bitbucket (right now). So, otherwise the MAC install should be fine.

Maybe this helps?

Jen
Galaxy team

On 8/10/12 8:00 AM, Edward Turk wrote:

Both responses worked for checking python version, but trying to
download gave an error:

Install Galaxy on Mac OS10.7
1. Open Applications/Utilities/Terminal.app
2. Check Python version by pasting in python -V, no quotes, and hit
return
*response = Python 2.7.1*
3. Get Galaxy by pasting in % hg clone
https://bitbucket.org/galaxy/galaxy-dist/;, no quotes, and hit return
*response = -bash: fg: %: no such job*
On Aug 10, 2012, at 8:58 AM, Hotz, Hans-Rudolf wrote:


Hi Edward

I am moving your e-mail to 'galaxy-dev' since it's about a local Galaxy
instance.

I don't think there are any differences between installing Galaxy on
Linux and Mac OS X. Hence you can follow the step-by-step instructions
on the wiki (well, there are actually only two steps anyway...):

http://wiki.g2.bx.psu.edu/Admin/Get%20Galaxy


WRT checking the python version:

just type 'python -V' on the command line, eg on my old MacBook:

bash-3.2$ python -V
Python 2.5.1
bash-3.2$


Hope this helps
Regards, Hans



On 08/10/2012 02:37 PM, Edward Turk wrote:

Hello,
Could someone provide instructions for installing galaxy on a Mac OS
10.7? The

instructions provided by galaxy start off by asking me to check my
python
version, but I don't know how to do that. I figure someone has
step-by-step
instructions or a screen cast?

Thank you,
Edward
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org http://usegalaxy.org.  Please keep all replies
on the list by
using reply all in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

http://lists.bx.psu.edu/







___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at 

Re: [galaxy-user] Install Galaxy on Mac

2012-08-10 Thread Edward Turk
Thanks Jen, Hans, and Scott,

I have it running on my laptop now and here are the steps I followed:

Install Galaxy on MacBook Pro OS10.7.4 (08-10-2012)
• Install Mercurial http://mercurial.selenic.com/wiki/
• Open Applications/Utilities/Terminal.app
• Confirm Mercurial installation by pasting in hg version, no quotes 
and hit return
response = version 2.3+20120807 
• Check Python version by pasting in python -V, no quotes and hit 
return
response = Python 2.7.1
• Go to your home directory by pasting in cd, no quotes and hit return
• Get Galaxy by pasting in hg clone 
http://bitbucket.org/galaxy/galaxy-dist/;, no quotes and hit return
• Go to the Galaxy directory by pasting in cd galaxy-dist, no quotes 
and hit return
• Start up Galaxy by pasting in sh run.sh, no quotes and hit return
• Open web browser and paste in “http://localhost:8080”, no quotes and 
hit return

Have a nice day,
Edward
On Aug 10, 2012, at 1:41 PM, Jennifer Jackson wrote:

 Update (and a post to both lists!)
 
 Nate pointed me to the real problem. https/http isn't a problem at bitbucket 
 anymore. The issue is where you are installing (/etc) and write permissions. 
 But, it is not recommended anyway. You will want to install in your home 
 directory. To get there, type:
 
  prompt$ cd
 
 Just that will put you in your home. To see where this is on your system 
 path, type this:
 
  prompt$ pwd
 
 To see what else is here, type:
 
  prompt$ ls
 
 
 A google for mac unix commands will bring up various basic help/tutorials and 
 such as you need them.
 
 Hopefully this gets you going!
 
 Jen
 Galaxy team
 
 On 8/10/12 9:59 AM, Jennifer Jackson wrote:
 Hi Edward,
 
 Sorry, the https is probably also a problem. I thought about
 commenting about that before, but was wasn't sure about how much help
 you would need exactly or if you were logged into bitbucket or not. So
 please use this:
 
   prompt$ hg clone http://bitbucket.org/galaxy/galaxy-dist
 
 If you ever need to clone again or update, the commands are in the News
 Brief summaries + top of each full report:
 http://wiki.g2.bx.psu.edu/DevNewsBriefs
 
 ** Note the % is used here to designate the terminal prompt. This is
 fairly common, so now that you know, you will be able to recognize it.
 Also look for the $ and  characters to represent the prompt at the
 start of a shared command line in various documents (Galaxy or other).
 I'll just use prompt$ right now to be clear.
 
 For Mercurial, to confirm the install, you can type at the terminal
 prompt from anywhere:
 
prompt$ hg version
prompt$ hg help
 
 The quick start and guide at http://mercurial.selenic.com/ is a good
 place for basic hg commands. A web search will return plenty of other
 choices.
 
 This is the last email in this thread I think we should send to both
 lists - from here forward let's just cc to galaxy-...@bx.psu.edu for
 follow-up and leave the user list off - no need to post to both. The
 other question about MAC resource we can do the same with, once answered.
 
 Best,
 
 Jen
 Galaxy team
 
 On 8/10/12 8:53 AM, Edward Turk wrote:
 Hi Jen,
 
 Yes, it is best to assume I know nothing about programming. I installed
 Mercurial, but don't know how to check that it was successful other than
 it said so. Removing % helped, but said I do not have permission:
 
 Install Galaxy on Mac OS10.7
 1. Open Applications/Utilities/Terminal.app
 2. Check Python version by pasting in python -V, no quotes, and hit
 return
 *response = Python 2.7.1*
 3. Install Mercurial
 *Response = Successful Installation but I don't know how to check
 this *
 4. Get Galaxy by pasting in hg clone
 https://bitbucket.org/galaxy/galaxy-dist/;, no quotes, and hit return
 *Response = warning: bitbucket.org http://bitbucket.org certificate
 with fingerprint
 24:9c:45:8b:9c:aa:ba:55:4e:01:6d:58:ff:e4:28:7d:2a:14:ae:3b not verified
 (check hostfingerprints or web.cacerts config setting)*
 *destination directory: galaxy-dist*
 *abort: Permission denied: /private/etc/galaxy-dist*
 
 Thanks,
 Edward
 On Aug 10, 2012, at 11:36 AM, Jennifer Jackson wrote:
 
 Hi Edward -
 
 This may sound very simple, but did the % get included in the
 command to do the download by mistake? You'll want to remove that from
 the command string run again (was used to note the terminal prompt, is
 not a part of the command). So, just this:
 
 prompt$  hg clone https://bitbucket.org/galaxy/galaxy-dist/
 
 I just tested the galaxy-dist repository and there are no issues at
 bitbucket (right now). So, otherwise the MAC install should be fine.
 
 Maybe this helps?
 
 Jen
 Galaxy team
 
 On 8/10/12 8:00 AM, Edward Turk wrote:
 Both responses worked for checking python version, but trying to
 download gave an error:
 
 Install Galaxy on Mac OS10.7
 1. Open Applications/Utilities/Terminal.app
 2. Check Python version by pasting in python -V, no quotes, and hit
 

[galaxy-user] (no subject)

2012-08-10 Thread Du, Jianguang
I am new to the NGS analysis. I need help to solve this problem.



As shown in my previous emial/question shown below, I have some paired-end 
datasets at FASTQ format, and I have problem to split each of these datasets 
into two datasets (one forward and one reverse).



Jennifer instructed me to assign the datatype to be fastqsanger first and then 
run 'Manipulate FASTQ'.



I have two questions:

1) Now that the datasets were already split into forward and reverse reads when 
extracted in FASTQ format from the SRA, can I use them just as single end data?

2) If I do need to split each dataset into two datasets, how should I choose 
the settings when I run Manipulte FASTQ?



Thanks.



Jianguang

/

On 8/10/12 7:21 AM, Du, Jianguang wrote:
 I have problem to split a paired-end FASTQ dataset into two separate
 datasets. In order to explain the problem clearly, I list the detail of
 what I did with my dataset:

 Step 1) My aim is to compare datasets for the differential alternative
 splicing. I downloaded paired-end datasets at FASTQ format from SRA of
 NCBI as original data.

 Below is part of my paired-end FASTQ dataset that I downloaed from SRA
 of NCBI, Does this dataset look OK?

 @SRR192532.1.1 HWI-EAS269:1:4:655:110.1 length=35
 GCTGAGTGAGGGTGTGTTTGGAGTTTG
 +SRR192532.1.1 HWI-EAS269:1:4:655:110.1 length=35
 I28II;II*2/5:++,(..*943F@I.('+.35'
 @SRR192532.1.2 HWI-EAS269:1:4:655:110.2 length=35
 AAAGATGTTAGTGATACGGAAAGGATATCTC
 +SRR192532.1.2 HWI-EAS269:1:4:655:110.2 length=35
 9+*9+7@?F1206,IGI+D122/0++-.+6/@?

 Step 2) Then I performed FASTQ groomer at setting as follows:

 a) Input FASTQ quality scores type: Illumina 1.3-1.7

 b)Advanced Options: Hide Advanced Options.

 Did I choose the right setting for FASTQ groomer? Should I use Advanced
 Options? If yes, what is the setting for Advances Options?

 Below is part of groomed dataset:

 @SRR192532.1.1 HWI-EAS269:1:4:655:110.1 length=35
 GCTGAGTGAGGGTGTGTTTGGAGTTTG
 +SRR192532.1.1 HWI-EAS269:1:4:655:110.1 length=35
 *!!**!**'!*
 @SRR192532.1.2 HWI-EAS269:1:4:655:110.2 length=35
 AAAGATGTTAGTGATACGGAAAGGATATCTC
 +SRR192532.1.2 HWI-EAS269:1:4:655:110.2 length=35
 '!*(*!%

 Does the groomed data look right? Is number represnting the member of a
 pair correct? Here they are .1 and .2, should they be /1 and /2?

 Step 3) Then I ran FASTQ splitter with the groomed files. There is not
 setting for the splitter. I chose the right groomed file and then click
 Excute. Below is the description of the splitted dataset:

 empty
 format:fastqsanger, database:hg19
 Info: Split 0 of 15277248 reads (0.00%).

 Please help me dela with this problem.

 Thanks.

 Jianguang Du

___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using reply all in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

[galaxy-user] need help to split paired-end dataset

2012-08-10 Thread Du, Jianguang
I am new to the NGS analysis. I need help to solve this problem.



As shown in my previous emial/question shown below, I have some paired-end 
datasets at FASTQ format, and I have problem to split each of these datasets 
into two datasets (one forward and one reverse).



Jennifer instructed me to assign the datatype to be fastqsanger first and then 
run 'Manipulate FASTQ'.



I have two questions:

1) Now that the datasets were already split into forward and reverse reads when 
extracted in FASTQ format from the SRA, can I use them just as single end data?

2) If I do need to split each dataset into two datasets, how should I choose 
the settings when I run Manipulte FASTQ?



Thanks.



Jianguang

/

On 8/10/12 7:21 AM, Du, Jianguang wrote:
 I have problem to split a paired-end FASTQ dataset into two separate
 datasets. In order to explain the problem clearly, I list the detail of
 what I did with my dataset:

 Step 1) My aim is to compare datasets for the differential alternative
 splicing. I downloaded paired-end datasets at FASTQ format from SRA of
 NCBI as original data.

 Below is part of my paired-end FASTQ dataset that I downloaed from SRA
 of NCBI, Does this dataset look OK?

 @SRR192532.1.1 HWI-EAS269:1:4:655:110.1 length=35
 GCTGAGTGAGGGTGTGTTTGGAGTTTG
 +SRR192532.1.1 HWI-EAS269:1:4:655:110.1 length=35
 I28II;II*2/5:++,(..*943F@I.('+.35'
 @SRR192532.1.2 HWI-EAS269:1:4:655:110.2 length=35
 AAAGATGTTAGTGATACGGAAAGGATATCTC
 +SRR192532.1.2 HWI-EAS269:1:4:655:110.2 length=35
 9+*9+7@?F1206,IGI+D122/0++-.+6/@?

 Step 2) Then I performed FASTQ groomer at setting as follows:

 a) Input FASTQ quality scores type: Illumina 1.3-1.7

 b)Advanced Options: Hide Advanced Options.

 Did I choose the right setting for FASTQ groomer? Should I use Advanced
 Options? If yes, what is the setting for Advances Options?

 Below is part of groomed dataset:

 @SRR192532.1.1 HWI-EAS269:1:4:655:110.1 length=35
 GCTGAGTGAGGGTGTGTTTGGAGTTTG
 +SRR192532.1.1 HWI-EAS269:1:4:655:110.1 length=35
 *!!**!**'!*
 @SRR192532.1.2 HWI-EAS269:1:4:655:110.2 length=35
 AAAGATGTTAGTGATACGGAAAGGATATCTC
 +SRR192532.1.2 HWI-EAS269:1:4:655:110.2 length=35
 '!*(*!%

 Does the groomed data look right? Is number represnting the member of a
 pair correct? Here they are .1 and .2, should they be /1 and /2?

 Step 3) Then I ran FASTQ splitter with the groomed files. There is not
 setting for the splitter. I chose the right groomed file and then click
 Excute. Below is the description of the splitted dataset:

 empty
 format:fastqsanger, database:hg19
 Info: Split 0 of 15277248 reads (0.00%).

 Please help me dela with this problem.

 Thanks.

 Jianguang Du

___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using reply all in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

Re: [galaxy-user] Install Galaxy on Mac

2012-08-10 Thread Jennifer Jackson

Hello Ted,

Workflows are included in the Galaxy Main Tool Shed

  http://toolshed.g2.bx.psu.edu/

-- Search for workflows

Documentation is in this wiki (see #22, 23,  24):

  http://wiki.g2.bx.psu.edu/Tool%20Shed


Other current information about workflow development can be found in the 
meeting notes from the 2012 GCC Breakout.



http://wiki.g2.bx.psu.edu/Events/GCC2012/Program/Breakouts/WorkflowsAndAPI

Best,

Jen
Galaxy team


On 8/10/12 1:31 PM, Ted Goldstein wrote:

Hi Jen,
I know we are using Mercurial for Galaxy's own source code.
Is there a way for Galaxy to store and retrieve workflows  from Mercurial?

Thanks,
Ted

UCSC CBSE

On Aug 10, 2012, at 1:06 PM, Jennifer Jackson wrote:


Hi Diana,

Galaxy itself will run on any recent MAC with the basic requirements (python, 
mercurial, etc.). The standard set-up isn't computationally intensive at all.

What makes a difference are the tools you intend to use, the size of the data 
(genomes, datasets, libraries), the volume of throughput, and processing speed 
expectations.

This wiki has some general guidelines that can help you decide between how to 
use Galaxy (Main, Local, or Cloud) based on these and related factors:
http://wiki.g2.bx.psu.edu/Big%20Picture/Choices

But what would be best, to address your specific question, is if you could 
provide more information about what you intend to do. Others on the mailing 
list would likely be able to comment about what type of set-up they are using 
successfully for similar work.

Best,

Jen
Galaxy team



On 8/10/12 8:53 AM, Diana Cox-Foster wrote:

I was wondering if anyone could comment on how memory/computational intensive a 
local instal of Galaxy is?  What type of computer (especially Macs) is needed 
for a local install to run fairly well?

Thanks for any info--- Diana
**
Diana Cox-Foster, Professor
office: 536 ASI Bldg

MAIL:
501 ASI Bldg
Department of Entomology
Penn State University
University Park, PA, USA 16802

email: dx...@psu.edu
office phone: 814-865-1022
dept. phone: 814-865-1895



--
Jennifer Jackson
http://galaxyproject.org
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using reply all in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

http://lists.bx.psu.edu/





--
Jennifer Jackson
http://galaxyproject.org
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using reply all in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

 http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

 http://lists.bx.psu.edu/


[galaxy-user] Extracting all CpG-SNPs from dbSNP135

2012-08-10 Thread Richard Henriksson

Dear Sir / Madam,

I'm new to Galaxy. Is there any way to extract all CpG-SNPs from  
dbSNP135 using Galaxy (preferably as a BED file, but a text file will  
do)? I tried to figure out myself, but came up short... All help is  
much appreciated!


Sincerely, RH

___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using reply all in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

 http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

 http://lists.bx.psu.edu/


Re: [galaxy-user] Install Galaxy on Mac

2012-08-10 Thread Hotz, Hans-Rudolf
Hi Edward

I am moving your e-mail to 'galaxy-dev' since it's about a local Galaxy
instance.

I don't think there are any differences between installing Galaxy on
Linux and Mac OS X. Hence you can follow the step-by-step instructions
on the wiki (well, there are actually only two steps anyway...):

http://wiki.g2.bx.psu.edu/Admin/Get%20Galaxy


WRT checking the python version:

just type 'python -V' on the command line, eg on my old MacBook:

bash-3.2$ python -V
Python 2.5.1
bash-3.2$


Hope this helps
Regards, Hans



On 08/10/2012 02:37 PM, Edward Turk wrote:
 Hello,
 Could someone provide instructions for installing galaxy on a Mac OS 10.7? The
instructions provided by galaxy start off by asking me to check my python
version, but I don't know how to do that. I figure someone has step-by-step
instructions or a screen cast?
 Thank you,
 Edward
 ___
 The Galaxy User list should be used for the discussion of
 Galaxy analysis and other features on the public server
 at usegalaxy.org.  Please keep all replies on the list by
 using reply all in your mail client.  For discussion of
 local Galaxy instances and the Galaxy source code, please
 use the Galaxy Development list:

http://lists.bx.psu.edu/listinfo/galaxy-dev

 To manage your subscriptions to this and other Galaxy lists,
 please use the interface at:

http://lists.bx.psu.edu/



___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using reply all in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/