Re: [galaxy-user] Read count issue with clipper/collapser
I've pinpointed the cause to be a hyphen followed by a numeric in the fasta header: if the header is: ILLUMINA-08A740_:8:1:2219:1057#0/1 then the read counts will not be accurate in the collapsed output. After the 'ILLUMINA', if I replace the -08 with _08, or delete the numbers so that it is -A740, then the count output is as expected. Only appears to apply to the second field after the first delimiter. Not sure if this is a known issue. From: kenec...@hotmail.com To: galaxy-u...@bx.psu.edu Date: Fri, 15 Apr 2011 00:29:49 + Subject: [galaxy-user] Read count issue with clipper/collapser Could someone take a look at this history in Galaxy? http://main.g2.bx.psu.edu/u/kenaka/h/count-issue collapser is not reporting the correct counts in the output for one of my files. seqdata1 and seqdata2 should both have 50 reads. Yet it is reporting more reads for seqdata1 in both the verbose reporting and the output. I have the same issue with the fastx_toolkit, as per below. What could be the cause? Thanks.Ken From: kenec...@hotmail.com To: galaxy-u...@bx.psu.edu Date: Thu, 14 Apr 2011 03:12:14 + Subject: Re: [galaxy-user] regarding read counts from fastx_clipper Apologies for the long content.. I seem to be having a discrepancy with fastx_collapser as well. I have converted from s_8_sequence_clipped.fa to s_8_sequence_collapsed.fa fastx_collapser -v -i s8_sequence_clipped.fa -o s8_sequence_collapsed.faInput: 26580941 sequences (representing 212647528 reads)--- what the..?Output: 3177400 sequences (representing 212647528 reads) In my collapsed file, my top read is: 1-35820208TACCTGGTTGATCCTGCCAGTAG (this is already over my original read count) When I grep -e TACCTGGTTGATCCTGCCAGTAG -c s_8_sequence_clipped.fa 4,503,566 Ok, I've reanalyzed a previous dataset and the output is consistent with my previous numbers: fastx_collapser -v -i s3-sequence.fa -o s4-sequence-RETEST.faInput: 36008043 sequences (representing 36008043 reads)Output: 3886503 sequences (representing 36008043 reads) so it doesn't appear to be the toolkit. How are the tools counting reads and sequences ?Could the format of the headers affect it? hyphens vs underscores? This data set:ILLUMINA-08A740_:8:1:1736:1055#0/1GCGAGCGTAGTTCAATGGTCATCTCCTTGCCAAGGA Previous data set:GAPC_0034_FC:1:1:1548:1028#0/1AAACTTCATCGTTATCGAGCGA Thanks From: kenec...@hotmail.com To: galaxy-u...@bx.psu.edu Date: Thu, 14 Apr 2011 00:54:05 + Subject: [galaxy-user] regarding read counts from fastx_clipper Hi, I'm using the fastx_toolkit (v0.0.13) command line scripts. When using fastx_clipper, I get: fastx_clipper -a TCGTATGCCGTCTTCTGCTTG -v -c -l 15 -M 5 -i s_8_sequence.fa -o s_8_sequence_clipped.faClipping Adapter: TCGTATGCCGTCTTCTGCTTGMin. Length: 15Non-Clipped reads - discarded.Input: 227673720 reads.Output: 212647528 reads.discarded 3527200 too-short reads.discarded 725608 adapter-only reads.discarded 10773384 non-clipped reads.discarded 0 N reads. The s_8_sequence.fa file is 2.2Gb, s_8_sequence_clipped.fa file is 1.7Gb seems like fastx_clipper is reporting way too many reads in this instance. I also tried without the -M option but same thing. I checked with: wc -l s_8_sequence.fa56918430(divide this by 2 gives 28,459,215 reads) wc -l s_8_sequence_clipped.fa53161882(divided by 2 gives 26,580,941 reads) There has never been such a discrepancy with this tool. I'm not sure if I'm doing something silly this time round, or somethings changed in my system that's affecting fastx_clipper counting. Heres a couple of lines from input and output: head -n 6 s_8_sequence.faILLUMINA-08A740_:8:1:1736:1055#0/1GCGAGCGTAGTTCAATGGTCATCTCCTTGCCAAGGAILLUMINA-08A740_:8:1:2219:1057#0/1CAAGCGTCGGAGGTTTAGTCTTTCGTATGCCGTCTTCTGCILLUMINA-08A740_:8:1:2316:1056#0/1TACCTGGTTGATCCTGCCAGTAGTCGTATGCCGTCTTCTG head -n 6 s_8_sequence_clipped.faILLUMINA-08A740_:8:1:2219:1057#0/1CAAGCGTCGGAGGTTTAGTCTTILLUMINA-08A740_:8:1:2316:1056#0/1TACCTGGTTGATCCTGCCAGTAGILLUMINA-08A740_:8:1:3041:1059#0/1GAAGCTGCGGGTTCGAGGTCAGTCCCGCCA Any ideas? Thanks, Ken ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the
Re: [galaxy-user] Histogram interpretation
Dear All I have combined H3K4me3 pattern in a specific region (Info: UCSC Main on Human: wgEncodeBroadHistoneGm12878CtcfStdPk (genome)) with RefSeq genes in that region (CSC Main on Human: refGene (genome)) and get this pdf histogram. I was wondering if someone help me on interpretation of it. Best regards. Moein M.Farshchian Ph.D Candidate of Cell Molecular Biology, Department of Biology, Faculty of Sciences, Ferdowsi University of Mashhad. Mashhad.Iran. P.O.Box: 9177948974 From: Peter Cock p.j.a.c...@googlemail.com To: Jeremy Goecks jeremy.goe...@emory.edu Cc: galaxy-user@lists.bx.psu.edu Sent: Fri, April 15, 2011 12:55:49 PM Subject: Re: [galaxy-user] Nucleotide analysis - GC percentage On Thu, Apr 14, 2011 at 6:25 PM, Jeremy Goecks jeremy.goe...@emory.edu wrote: Now why does a tool search on the public Galaxy instance for GC not suggest this tool? Name: geecee Description: Calculates fractional GC content of nucleic acid sequences Does this mean the description isn't searched? It would seem like a sensible idea to me to include that... Searching for geecee works, but unless you're familiar with this EMBOSS tool no-one will think of that. Peter, The tool search doesn't start until you type in three characters, so typing 'GC' does not initiate a search. Typing 'gcspace' or 'gc content' works. Perhaps a tooltip or help text is needed. J. I see that now, and yes, perhaps a caption on the search box would help... Also typing C, C, enter doesn't work - that does surprise me. There is still something amiss with the search apparently not using the tool description line, for instance neither acid nor nucleic nor factional show the EMBOSS geecee tool. If the search is indexing on the tool's main help text, then for the EMBOSS tools it would help to have an executive summary with key words in it, rather than just a link to the EMBOSS webpage for each tool. Peter ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ Galaxy7-[Histogram_on_data_6].pdf Description: Adobe PDF document ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Help!!!!!! with Galaxy Cloud!!!!!
Hello again, So I am able to see all of the .dat files in /mnt/galaxyData. What commands can I use to download a file to my HD? Also, what program should I use to open the .dat file? Thanks again, Mike --- On Wed, 4/13/11, Enis Afgan eaf...@emory.edu wrote: From: Enis Afgan eaf...@emory.edu Subject: Re: [galaxy-user] Help!! with Galaxy Cloud! To: Mike Dufault dufau...@yahoo.com Cc: galaxy-u...@bx.psu.edu Date: Wednesday, April 13, 2011, 11:15 PM Hi Mike, Once the given EBS volume is attached and mounted, all of the data should be in /mnt/galaxyData/files/000/This assumes the file system is mounted to /mnt/galaxyData, which is where it would get mounted to automatically by cloudman on cluster instantiation. Enis On Wed, Apr 13, 2011 at 9:00 PM, Mike Dufault dufau...@yahoo.com wrote: Hi Enis, I started to use the terminal to check to see if the job was running, but it stopped successfully at the same time. Thanks again for helping me to complete the run. Now I have an additional issue. I wanted to save my BAM file, but I kept getting an error. I think the error was because it was too large to send (4.1GB). So I saved what I could to my local HD and terminated the cluster. My EBS volume is 200GB and persisted after the cluster was terminated. I assume that my BAM file resides somewhere in the EBS volume. I started a new Unix cluster and attached the EBS to that cluster. I also established an ssh to the Unis cluster but I do not know where to find the BAM file. Do you know how I can access the BAM file so that I can transfer it to my local HD? Thanks, Mike --- On Wed, 4/13/11, Enis Afgan eaf...@emory.edu wrote: From: Enis Afgan eaf...@emory.edu Subject: Re: [galaxy-user] Help!! with Galaxy Cloud! To: vasu punj pu...@yahoo.com Cc: galaxy-u...@bx.psu.edu Date: Wednesday, April 13, 2011, 10:01 AM Hi Vasu, I am not sure I understand your question but the general instructions on how to get started and use Galaxy on the cloud (i.e., Cloudman) are available at usegalaxy.org/cloud Let us know if you that page does not answer your questions, Enis On Wed, Apr 13, 2011 at 9:40 AM, vasu punj pu...@yahoo.com wrote: I was wondering if there are instructions how can I run the Galaxy on CloudConsole, Indeed first I want to know how Galaxy is established on console? Can someone direct me to the instructions please. Thanks. --- On Tue, 4/12/11, Enis Afgan eaf...@emory.edu wrote: From: Enis Afgan eaf...@emory.edu Subject: Re: [galaxy-user] Help!! with Galaxy Cloud! To: Mike Dufault dufau...@yahoo.com Cc: galaxy-u...@bx.psu.edu Date: Tuesday, April 12, 2011, 9:31 PM Galaxy has the functionality to recover any jobs that were running after it's restarted so it is quite possible to for the job to still be running. In addition, from the cloudman console, it appears that at least one instance is pretty heavily loaded so that can also mean that the job is still running. However, without actually accessing the instance through the command line and checking the status of the job queue, it is not possible to tell if the job is - actually running. Do you know how to do that? It's just a few commands in the terminal: - access the instance [local]$ ssh -i path to the private key you downloaded from AWS when you created a key pair ubuntu@instance public DNS - become galaxy user [ec2]$ sudo su galaxy - list any running jobs [ec2]$ qstat If that command returns a list of jobs and the jobs are in stare 'r' (running), the job is still running; otherwise, no. Let me know how it goes, Enis On Tue, Apr 12, 2011 at 9:49 PM, Mike Dufault dufau...@yahoo.com wrote: Hi Enis, THANK YOU!!! I see that my filter pileup on data step is running. Is this the same analysis that was running before or did it relauch when you restarted Galaxy? I just don't know if the analysis would be compromised. Thanks again to you and the whole Galaxy team. Best, Mike --- On Tue, 4/12/11, Enis Afgan eaf...@emory.edu wrote: From: Enis Afgan eaf...@emory.edu Subject: Re: [galaxy-user] Help!! with Galaxy Cloud! To: Mike Dufault dufau...@yahoo.com Cc: Anton Nekrutenko an...@bx.psu.edu, galaxy-u...@bx.psu.edu Date: Tuesday, April 12, 2011, 9:16 PM Ahh, for some reason cloudman is thinking Galaxy is not 'running' but still 'starting' and has thus not enabled the given button. To access the analysis, in your browser, just delete the '/cloud' part of the URL and that should load Galaxy. Sorry about the confusion, Enis On Tue, Apr 12, 2011 at 9:12 PM, Mike Dufault dufau...@yahoo.com wrote: Hi Enis, Thanks for looking into this. From the Galaxy Cloudman Console, I can see that it was restarted from the log (thanks), but the Access Galaxy choice is still grayed out and I don't know how to access the Analysis window. Is there a way back into my analysis? Thanks, Mike --- On Tue, 4/12/11, Enis Afgan
Re: [galaxy-user] Help!!!!!! with Galaxy Cloud!!!!!
Hi Mike, You should be able to download the desired file(s) directly from Galaxy by expanding the desired history item and then clicking the 'disk' (i.e., download) icon. Alternatively, if you want to copy the file by hand directly from the file system on the instance, the following is the command to execute (note that the command is executed from your local machine): scp -i path to your AWS key pair file ubuntu@instance public DNS:/mnt/galaxyData/files/000/file name . (also, note the '.' at the end of the command) This command will copy the remote file to your local machine and it will put it in your current directory. Once downloaded, the file can probably be opened with any text editor (unless it's a binary file, in which case it will have to be opened with the appropriate tool that can read the given file format). Enis On Fri, Apr 15, 2011 at 12:32 AM, Mike Dufault dufau...@yahoo.com wrote: Hello again, So I am able to see all of the .dat files in /mnt/galaxyData. What commands can I use to download a file to my HD? Also, what program should I use to open the .dat file? Thanks again, Mike --- On *Wed, 4/13/11, Enis Afgan eaf...@emory.edu* wrote: From: Enis Afgan eaf...@emory.edu Subject: Re: [galaxy-user] Help!! with Galaxy Cloud! To: Mike Dufault dufau...@yahoo.com Cc: galaxy-u...@bx.psu.edu Date: Wednesday, April 13, 2011, 11:15 PM Hi Mike, Once the given EBS volume is attached and mounted, all of the data should be in /mnt/galaxyData/files/000/ This assumes the file system is mounted to /mnt/galaxyData, which is where it would get mounted to automatically by cloudman on cluster instantiation. Enis On Wed, Apr 13, 2011 at 9:00 PM, Mike Dufault dufau...@yahoo.comhttp://mc/compose?to=dufau...@yahoo.com wrote: Hi Enis, I started to use the terminal to check to see if the job was running, but it stopped successfully at the same time. Thanks again for helping me to complete the run. Now I have an additional issue. I wanted to save my BAM file, but I kept getting an error. I think the error was because it was too large to send (4.1GB). So I saved what I could to my local HD and terminated the cluster. My EBS volume is 200GB and persisted after the cluster was terminated. I assume that my BAM file resides somewhere in the EBS volume. I started a new Unix cluster and attached the EBS to that cluster. I also established an ssh to the Unis cluster but I do not know where to find the BAM file. Do you know how I can access the BAM file so that I can transfer it to my local HD? Thanks, Mike --- On *Wed, 4/13/11, Enis Afgan eaf...@emory.eduhttp://mc/compose?to=eaf...@emory.edu * wrote: From: Enis Afgan eaf...@emory.edu http://mc/compose?to=eaf...@emory.edu Subject: Re: [galaxy-user] Help!! with Galaxy Cloud! To: vasu punj pu...@yahoo.com http://mc/compose?to=pu...@yahoo.com Cc: galaxy-u...@bx.psu.edu http://mc/compose?to=galaxy-u...@bx.psu.edu Date: Wednesday, April 13, 2011, 10:01 AM Hi Vasu, I am not sure I understand your question but the general instructions on how to get started and use Galaxy on the cloud (i.e., Cloudman) are available at usegalaxy.org/cloud Let us know if you that page does not answer your questions, Enis On Wed, Apr 13, 2011 at 9:40 AM, vasu punj pu...@yahoo.comhttp://us.mc1137.mail.yahoo.com/mc/compose?to=pu...@yahoo.com wrote: I was wondering if there are instructions how can I run the Galaxy on CloudConsole, Indeed first I want to know how Galaxy is established on console? Can someone direct me to the instructions please. Thanks. --- On *Tue, 4/12/11, Enis Afgan eaf...@emory.eduhttp://us.mc1137.mail.yahoo.com/mc/compose?to=eaf...@emory.edu * wrote: From: Enis Afgan eaf...@emory.eduhttp://us.mc1137.mail.yahoo.com/mc/compose?to=eaf...@emory.edu Subject: Re: [galaxy-user] Help!! with Galaxy Cloud! To: Mike Dufault dufau...@yahoo.comhttp://us.mc1137.mail.yahoo.com/mc/compose?to=dufau...@yahoo.com Cc: galaxy-u...@bx.psu.eduhttp://us.mc1137.mail.yahoo.com/mc/compose?to=galaxy-u...@bx.psu.edu Date: Tuesday, April 12, 2011, 9:31 PM Galaxy has the functionality to recover any jobs that were running after it's restarted so it is quite possible to for the job to still be running. In addition, from the cloudman console, it appears that at least one instance is pretty heavily loaded so that can also mean that the job is still running. However, without actually accessing the instance through the command line and checking the status of the job queue, it is not possible to tell if the job is - actually running. Do you know how to do that? It's just a few commands in the terminal: - access the instance [local]$ ssh -i path to the private key you downloaded from AWS when you created a key pair ubuntu@instance public DNS - become galaxy user [ec2]$ sudo su galaxy - list any running jobs [ec2]$ qstat If that command returns a list of jobs and
Re: [galaxy-user] Help!!!!!! with Galaxy Cloud!!!!!
I don't think you'll need to convert the file other than maybe renaming the extension (mv filename.dat filename.bam) because Galaxy just adds that same extension to each file while the metadata that it keeps tell it which format the file is in. Just try opening the file up using the tool you were planning to use and it should work. Enis On Fri, Apr 15, 2011 at 8:49 AM, Mike Dufault dufau...@yahoo.com wrote: Hi Enis, With the exception of the BAM file (4.1Gb) I have been able to download everything that I have tried using the disk from the history panel. I think the 4.1Gb file is just too large because I keep getting a memory error. Since I am still new to the whole AWS-EC2 set-up, I have not fooled around to much with the instance set up. I have followed the screen-cast give by Anton. Perhaps I need to change the memory settings when I create the instance. It seems it would be better if I could download if from the disk icon since then it would be in the correct BAM format. Anyway, I will try scp directions that you have provided and find out how to convert from .dat back to (or somehow extract the) BAM file once I get it to my local machine. Each step is one step closer. Thanks again, Mike --- On *Fri, 4/15/11, Enis Afgan eaf...@emory.edu* wrote: From: Enis Afgan eaf...@emory.edu Subject: Re: [galaxy-user] Help!! with Galaxy Cloud! To: Mike Dufault dufau...@yahoo.com Cc: galaxy-u...@bx.psu.edu Date: Friday, April 15, 2011, 8:21 AM Hi Mike, You should be able to download the desired file(s) directly from Galaxy by expanding the desired history item and then clicking the 'disk' (i.e., download) icon. Alternatively, if you want to copy the file by hand directly from the file system on the instance, the following is the command to execute (note that the command is executed from your local machine): scp -i path to your AWS key pair file ubuntu@instance public DNS:/mnt/galaxyData/files/000/file name . (also, note the '.' at the end of the command) This command will copy the remote file to your local machine and it will put it in your current directory. Once downloaded, the file can probably be opened with any text editor (unless it's a binary file, in which case it will have to be opened with the appropriate tool that can read the given file format). Enis On Fri, Apr 15, 2011 at 12:32 AM, Mike Dufault dufau...@yahoo.comhttp://mc/compose?to=dufau...@yahoo.com wrote: Hello again, So I am able to see all of the .dat files in /mnt/galaxyData. What commands can I use to download a file to my HD? Also, what program should I use to open the .dat file? Thanks again, Mike --- On *Wed, 4/13/11, Enis Afgan eaf...@emory.eduhttp://mc/compose?to=eaf...@emory.edu * wrote: From: Enis Afgan eaf...@emory.edu http://mc/compose?to=eaf...@emory.edu Subject: Re: [galaxy-user] Help!! with Galaxy Cloud! To: Mike Dufault dufau...@yahoo.comhttp://mc/compose?to=dufau...@yahoo.com Cc: galaxy-u...@bx.psu.edu http://mc/compose?to=galaxy-u...@bx.psu.edu Date: Wednesday, April 13, 2011, 11:15 PM Hi Mike, Once the given EBS volume is attached and mounted, all of the data should be in /mnt/galaxyData/files/000/ This assumes the file system is mounted to /mnt/galaxyData, which is where it would get mounted to automatically by cloudman on cluster instantiation. Enis On Wed, Apr 13, 2011 at 9:00 PM, Mike Dufault dufau...@yahoo.comhttp://mc/compose?to=dufau...@yahoo.com wrote: Hi Enis, I started to use the terminal to check to see if the job was running, but it stopped successfully at the same time. Thanks again for helping me to complete the run. Now I have an additional issue. I wanted to save my BAM file, but I kept getting an error. I think the error was because it was too large to send (4.1GB). So I saved what I could to my local HD and terminated the cluster. My EBS volume is 200GB and persisted after the cluster was terminated. I assume that my BAM file resides somewhere in the EBS volume. I started a new Unix cluster and attached the EBS to that cluster. I also established an ssh to the Unis cluster but I do not know where to find the BAM file. Do you know how I can access the BAM file so that I can transfer it to my local HD? Thanks, Mike --- On *Wed, 4/13/11, Enis Afgan eaf...@emory.eduhttp://mc/compose?to=eaf...@emory.edu * wrote: From: Enis Afgan eaf...@emory.edu http://mc/compose?to=eaf...@emory.edu Subject: Re: [galaxy-user] Help!! with Galaxy Cloud! To: vasu punj pu...@yahoo.com http://mc/compose?to=pu...@yahoo.com Cc: galaxy-u...@bx.psu.edu http://mc/compose?to=galaxy-u...@bx.psu.edu Date: Wednesday, April 13, 2011, 10:01 AM Hi Vasu, I am not sure I understand your question but the general instructions on how to get started and use Galaxy on the cloud (i.e., Cloudman) are available at usegalaxy.org/cloud Let us know if you that page does not answer your questions,
Re: [galaxy-user] Nucleotide analysis - GC percentage
please remove me from mailing list - thanks On 14-04-2011, at 9:26 AM, Guru Ananda wrote: Thanks for pointing this out, Brad. Both geecee and infoseq are in fact available on Galaxy under EMBOSS section. Guru. On Thu, Apr 14, 2011 at 12:13 PM, Brad Chapman chapm...@50mail.com wrote: Peter and Guru; [Computing GC] I'll be working with simple sequence files (FASTA, or even FASTQ, SFF, etc) rather than BED files, but I'll keep that in mind. Emboss has some utilities that do this. infoseq and geecee, and there are also programs for exploring CpG islands: http://emboss.sourceforge.net/apps/release/6.3/emboss/apps/nucleic_cpg_islands_group.html Brad -- Graduate student, Bioinformatics and Genomics Makova lab/Galaxy team 505 Wartik lab University Park PA 16802 g...@psu.edu ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] unsubscribe
I have the same trouble as Giovanni, too. The confirmation email for unsubscription never arrived. It would be very nice if someone could help remove my email from the subscription list. Thanks! On Fri, Apr 15, 2011 at 11:53 AM, nic blouin nblo...@mail.uri.edu wrote: I am having the same trouble as Giovanni. i have unsubrcribed from the individual list and all several times, but the emails keep coming at a brisk pace. Is there someone who can help out ... Hi, I have been trying to unsubscribe from this list as it jams up my inbox. I read that a confirmation will be send but that e-mail has never arrived. I there a way anyone can remove my e-mail address? Thanks. ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ nic Nicolas Achille Blouin, Ph.D. Dept. of Biological Sciences Univeristy of Rhode Island 120 Flagg Road, CBLS 287 Kingston, RI 02881 401.874.9730 nblo...@mail.uri.edu ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ -- Yi Yin University Program in Genetics Genomics Duke University ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
[galaxy-user] database on the cloud
I set up a galaxy instance on the cloud, but got the following error when trying to convert a bed file of hg18 coordinates to fasta sequence with the Extract Genomic DNA tool as a test of the functionality of this instance: No sequences are available for 'hg18', request them by reporting this error. Where did I go wrong? Likely I would get a similar error for other databases and indexes I might need and the instructions on the bitbucket site does not cover this (https://bitbucket.org/galaxy/galaxy-central/wiki/cloud). Otherwise this is a very nice setup. Thomas Randall, PhD Bioinformatics Scientist, Contractor National Institute of Environmental Health Sciences P.O. Box 12233, Research Triangle Park, NC 27709 randall...@niehs.nih.govmailto:randall...@niehs.nih.gov 919-541-2271 ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] unsubscribe
AgreedI'm also having the same issues! David Schwartz From: Yi Yin fourthnat...@gmail.com Date: Fri, 15 Apr 2011 12:00:06 -0400 To: nic blouin nblo...@mail.uri.edu Cc: galaxy-user@lists.bx.psu.edu Subject: Re: [galaxy-user] unsubscribe I have the same trouble as Giovanni, too. The confirmation email for unsubscription never arrived. It would be very nice if someone could help remove my email from the subscription list. Thanks! On Fri, Apr 15, 2011 at 11:53 AM, nic blouin nblo...@mail.uri.edu wrote: I am having the same trouble as Giovanni. i have unsubrcribed from the individual list and all several times, but the emails keep coming at a brisk pace. Is there someone who can help out .. . Hi, I have been trying to unsubscribe from this list as it jams up my inbox. I read that a confirmation will be send but that e-mail has never arrived. I there a way anyone can remove my e-mail address? Thanks. ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org http://usegalaxy.org/ . Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ nic Nicolas Achille Blouin, Ph.D. Dept. of Biological Sciences Univeristy of Rhode Island 120 Flagg Road, CBLS 287 Kingston, RI 02881 401.874.9730 tel:401.874.9730 nblo...@mail.uri.edu ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org http://usegalaxy.org . Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ -- Yi Yin University Program in Genetics Genomics Duke University ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
[galaxy-user] SAM to BAM conversion problem
Hello Galaxy Support, I generated an alignment with a fastq groomed illumina dataset using the Map with BWA tool in galaxy with the C. elegans ce6 genome. Interestingly the results (when I click on the history name) say that the database used was ce7. When I try to use the SAM-to-BAM tool, I am getting a sequences are not currently available for specified build error. Thanks, Hemant ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
