[galaxy-user] Citing Galaxy

2011-07-07 Thread Sher, Falak 
I did ChIP-Seq analysis using Galaxy; I was just wandering which one is most 
relevant article to cite Galaxy for this kind of work (ChIP-Seq)

Thank you in advance,

Falak

___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using reply all in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

[galaxy-user] Bowtie

2011-04-26 Thread Sher, Falak 
Hi Experts,

I have single end Illumina reads from ChIP-Seq experiment. The files have 
encoding Illumina 1.5, and the sequence length is 76bp.

After basic FastQc I want to map the sequences using Bowtie. My question is:

do I need to split my reads (farward and backward) before running mapping tool?

 In one of Galaxy screen shorts reads are spitted while not in the other.

Thank you in advance,
F

___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using reply all in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

[galaxy-user] Galaxy server-FTP

2011-03-31 Thread Sher, Falak 
HI
I would like to use Galaxy server to upload files via FTP. I seek help for, log 
in to the FTP server at main.g2.bx.psu.edu.
I dont see ftp log in option there.
help please ?


Falak

___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using reply all in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

Re: [galaxy-user] Convert SOLiD data

2011-03-28 Thread Sher, Falak 
Hello collegues,
I have two questions which I could not get answered.
I have Illumina single end sequences files, and want to use  them for ChIP-Seq 
analysis.
My first question is:
In Galaxy screencasts (ChIP-Seq analysis for TAF1-protein...) he does not tell 
how he has generated the txt. format of the file used for demonstration of 
ChIP-Seq analysis.
I would like to know how I can generate that file from my Illumina sequence 
files to proceed with analysis.
My second question is,
2) How can I convert SAM/BAM formated files (generated by Bowtei mapping tool 
at Galaxy) to Wiggle or Bigwig formats.
I would be thankful for the answers and comments.
Falak



From: galaxy-user-boun...@lists.bx.psu.edu 
[galaxy-user-boun...@lists.bx.psu.edu] On Behalf Of Jennifer Jackson 
[j...@bx.psu.edu]
Sent: Monday, March 28, 2011 9:57 AM
To: lishiyong
Cc: galaxy-user
Subject: Re: [galaxy-user] Convert SOLiD data

Hello Lishiyong,

Just to confirm, the conversion was performed at Galaxy main using NGS:
QC and manipulation - Convert SOLiD output to fastq? With the option
double encode = yes? If so, the output appears to be correct.

quote from tool help:

Double encode? - converts color calls (0123.) to pseudo-nucleotides
(ACGTN). Not necessary for bowtie. Required for BWA.

Please let us know if we can help more,

Best,

Jen
Galaxy team

On 3/27/11 8:35 PM, lishiyong wrote:
 Hello!

 I convert SOLiD csfasta- and qual-files to fastq-files ,I want to use
 the fastq-files to do denovo with *SOAPdenovo*.because the SOLiD de novo
 accessory tools Require large memory .But ,I find that there're some
 question for the converting .

 for example:

 T0202322110210103200200203001123212113333311200 ——
 AGAGTGGCCAGCACATGAAGAAGATAACCGTGCGCCTTTTTCCGAA
 But I think it should to be
 TCCTAGACAAGTTGGCTTTCCCTTAAACAGCTGACATAGAGATATGTCCC Who knows the reason
 about this.
 2011-03-28
 
 lishiyong



 ___
 The Galaxy User list should be used for the discussion of
 Galaxy analysis and other features on the public server
 at usegalaxy.org.  Please keep all replies on the list by
 using reply all in your mail client.  For discussion of
 local Galaxy instances and the Galaxy source code, please
 use the Galaxy Development list:

http://lists.bx.psu.edu/listinfo/galaxy-dev

 To manage your subscriptions to this and other Galaxy lists,
 please use the interface at:

http://lists.bx.psu.edu/

--
Jennifer Jackson
http://usegalaxy.org
http://galaxyproject.org
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using reply all in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using reply all in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/