Re: [galaxy-user] help for trim sequences
You might also use ( / add to main) the CutAdapt tool, which is available in the main toolshed. It takes multiple adapters, allows 3/5/both side adapters, and is fast. http://toolshed.g2.bx.psu.edu/repository/view_repository?sort=User.usernameoperation=view_or_manage_repositoryid=f19bc86bac946438 Best, Geert On 11/23/2013 03:19 PM, Peter Cock wrote: On Fri, Nov 22, 2013 at 8:48 PM, Jennifer Jackson j...@bx.psu.edu wrote: Hi Seung Hee, I know we discussed this on the other list, but I didn't point you to the open development ticket to (potentially) extend the functions of the Cut tool. This is not being actively worked on right now, but you can follow it for updates if you want. https://trello.com/c/CbFSHrU5 Others are still welcome to comment about what types of solutions they might have to offer. There is no specific tool to do this on Main right now (or in the Tool Shed, from my checks). http://usegalaxy.org/toolshed This tool of mine might do what Seung Hee wanted, but I have not tried it on very large Illumina datasets: http://toolshed.g2.bx.psu.edu/view/peterjc/seq_primer_clip Regards, Peter ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/ -- Geert Vandeweyer, Ph.D. Department of Medical Genetics University of Antwerp Prins Boudewijnlaan 43 2650 Edegem Belgium Tel: +32 (0)3 275 97 56 E-mail: geert.vandewe...@ua.ac.be http://ua.ac.be/cognitivegenetics http://www.linkedin.com/in/geertvandeweyer ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
Re: [galaxy-user] help for trim sequences
Thanks Geert, This tool was in the back on my mind, but I couldn't find it last week for some reason! Seung Hee - this is a very good choice, for use in a local or or cloud Galaxy. http://getgalaxy.org http://usegalaxy.org/cloud I think I will close out the ticket below and point it to CutAdapt as a solution. A ticket to ask for this tool to be on Main is a distinct subject/issue - if someone wants to submit that request, the community can vote, team can priotitize, etc. http://wiki.galaxyproject.org/Issues The tool Peter mentions can also be examined. One may fit your needs better than the other, Thanks!! Jen Galaxy team On 11/25/13 6:03 AM, Geert Vandeweyer wrote: You might also use ( / add to main) the CutAdapt tool, which is available in the main toolshed. It takes multiple adapters, allows 3/5/both side adapters, and is fast. http://toolshed.g2.bx.psu.edu/repository/view_repository?sort=User.usernameoperation=view_or_manage_repositoryid=f19bc86bac946438 Best, Geert On 11/23/2013 03:19 PM, Peter Cock wrote: On Fri, Nov 22, 2013 at 8:48 PM, Jennifer Jacksonj...@bx.psu.edu wrote: Hi Seung Hee, I know we discussed this on the other list, but I didn't point you to the open development ticket to (potentially) extend the functions of the Cut tool. This is not being actively worked on right now, but you can follow it for updates if you want. https://trello.com/c/CbFSHrU5 Others are still welcome to comment about what types of solutions they might have to offer. There is no specific tool to do this on Main right now (or in the Tool Shed, from my checks).http://usegalaxy.org/toolshed This tool of mine might do what Seung Hee wanted, but I have not tried it on very large Illumina datasets: http://toolshed.g2.bx.psu.edu/view/peterjc/seq_primer_clip Regards, Peter ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/ -- Geert Vandeweyer, Ph.D. Department of Medical Genetics University of Antwerp Prins Boudewijnlaan 43 2650 Edegem Belgium Tel: +32 (0)3 275 97 56 E-mail:geert.vandewe...@ua.ac.be http://ua.ac.be/cognitivegenetics http://www.linkedin.com/in/geertvandeweyer ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/ -- Jennifer Hillman-Jackson http://galaxyproject.org ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
Re: [galaxy-user] help for trim sequences
Thanks Peter for another option! Jen Galaxy team On 11/23/13 6:19 AM, Peter Cock wrote: On Fri, Nov 22, 2013 at 8:48 PM, Jennifer Jackson j...@bx.psu.edu wrote: Hi Seung Hee, I know we discussed this on the other list, but I didn't point you to the open development ticket to (potentially) extend the functions of the Cut tool. This is not being actively worked on right now, but you can follow it for updates if you want. https://trello.com/c/CbFSHrU5 Others are still welcome to comment about what types of solutions they might have to offer. There is no specific tool to do this on Main right now (or in the Tool Shed, from my checks). http://usegalaxy.org/toolshed This tool of mine might do what Seung Hee wanted, but I have not tried it on very large Illumina datasets: http://toolshed.g2.bx.psu.edu/view/peterjc/seq_primer_clip Regards, Peter -- Jennifer Hillman-Jackson http://galaxyproject.org ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
Re: [galaxy-user] help for trim sequences
Hi Seung Hee, You can request that this tool be added to the public Main server at usegalaxy.org through Trello and the team will consider it. For right now, the options are local or cloud. (as in my other reply) Or, you can look around the the other public servers hosted by our community - each is run by a distinct group with their own contact/help/public-use criteria: http://wiki.galaxyproject.org/PublicGalaxyServers It may be simplest to see if a local will do the job, then upload the results to the public server for downstream analysis. Just do the very basics of a production server install and then add the tool to test it out. This will take some line commands to set up, but shouldn't be too much of an investment. The links are: http://getgalaxy.org http://usegalaxy.org/toolshed http://wiki.galaxyproject.org/Tool%20Shed#Installing.2C_maintaining_and_uninstalling_tool_shed_repositories_within_a_Galaxy_instance Local install help/discussion: galaxy-...@bx.psu.edu Subscribe or search prior Q/A: http://wiki.galaxyproject.org/MailingLists Take care, Jen Galaxy team On 11/25/13 11:29 AM, Seung Hee Cho wrote: Thank you for much for your great help! I am trying to use this tool but I am wondering if I can use this CutAdapt tools on the public server. I was working on my job on the public server, so if not I need download it for use. I truly appreciate your help! Best, *Seung Hee Cho* Contreras Research Group, CPE 5.416 The University of Texas at Austin Department of Chemical Engineering 200 E Dean Keeton St. Stop C0400 Austin, TX 78712-1589 On Mon, Nov 25, 2013 at 10:08 AM, Jennifer Jackson j...@bx.psu.edu mailto:j...@bx.psu.edu wrote: Thanks Peter for another option! Jen Galaxy team On 11/23/13 6:19 AM, Peter Cock wrote: On Fri, Nov 22, 2013 at 8:48 PM, Jennifer Jackson j...@bx.psu.edu mailto:j...@bx.psu.edu wrote: Hi Seung Hee, I know we discussed this on the other list, but I didn't point you to the open development ticket to (potentially) extend the functions of the Cut tool. This is not being actively worked on right now, but you can follow it for updates if you want. https://trello.com/c/CbFSHrU5 Others are still welcome to comment about what types of solutions they might have to offer. There is no specific tool to do this on Main right now (or in the Tool Shed, from my checks). http://usegalaxy.org/toolshed This tool of mine might do what Seung Hee wanted, but I have not tried it on very large Illumina datasets: http://toolshed.g2.bx.psu.edu/view/peterjc/seq_primer_clip Regards, Peter -- Jennifer Hillman-Jackson http://galaxyproject.org -- Jennifer Hillman-Jackson http://galaxyproject.org ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
Re: [galaxy-user] help for trim sequences
On Fri, Nov 22, 2013 at 8:48 PM, Jennifer Jackson j...@bx.psu.edu wrote: Hi Seung Hee, I know we discussed this on the other list, but I didn't point you to the open development ticket to (potentially) extend the functions of the Cut tool. This is not being actively worked on right now, but you can follow it for updates if you want. https://trello.com/c/CbFSHrU5 Others are still welcome to comment about what types of solutions they might have to offer. There is no specific tool to do this on Main right now (or in the Tool Shed, from my checks). http://usegalaxy.org/toolshed This tool of mine might do what Seung Hee wanted, but I have not tried it on very large Illumina datasets: http://toolshed.g2.bx.psu.edu/view/peterjc/seq_primer_clip Regards, Peter ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
Re: [galaxy-user] help for trim sequences
Hi Seung Hee, I know we discussed this on the other list, but I didn't point you to the open development ticket to (potentially) extend the functions of the Cut tool. This is not being actively worked on right now, but you can follow it for updates if you want. https://trello.com/c/CbFSHrU5 Others are still welcome to comment about what types of solutions they might have to offer. There is no specific tool to do this on Main right now (or in the Tool Shed, from my checks). http://usegalaxy.org/toolshed Take care, Jen Galaxy team On 11/18/13 12:56 PM, Seung Hee Cho wrote: Hi, I am a galazy user and I want to trim exact sequences (not the location) from 5' end. Is there any tool I can use for this? For example, *AATGATACGGC_GACCACCG _*_AACACTGCGTTTGCTGGCTTTG_ATG From this sequence, I want to remove *AATGATACGGC_GACCACCG,_* *_so I can get _ *_AACACTGCGTTTGCTGGCTTTG_ATG only. If I use trim sequences or FASTX trimmer, then it will be trimmed absolute position. It would be great help. Thank you so much! Best, *Seung Hee * ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/ -- Jennifer Hillman-Jackson http://galaxyproject.org ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
[galaxy-user] help for trim sequences
Hi, I am a galazy user and I want to trim exact sequences (not the location) from 5' end. Is there any tool I can use for this? For example, *AATGATACGGCGACCACCG **AACACTGCGTTTGCTGGCTTTG*ATG From this sequence, I want to remove *AATGATACGGCGACCACCG,* *so I can get**AACACTGCGTTTGCTGGCTTTG*ATG only. If I use trim sequences or FASTX trimmer, then it will be trimmed absolute position. It would be great help. Thank you so much! Best, *Seung Hee * ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
