Hello!
aspects.py is a lightweight and low-level library for intercepting
function calls. Functions and methods (also in Python standard library
and third party code) can be wrapped so that when they are called, the
wrap is invoked first. Depending on the wrap, the execution of the
original
Announce: Python Bootcamp at Big Nerd Ranch.
November 10-14, 2008
Atlanta, Georgia
http://www.bignerdranch.com/classes/python.shtml
Economic news got you down? It's not too register for a total escape
at Big Nerd Ranch where the upcoming Python Bootcamp will put you on
the fast path to becoming
Hi,
On Oct 8, 6:36 pm, Rajanikanth Jammalamadaka [EMAIL PROTECTED]
wrote:
Hi!
Is there a functional way to do this?
I have an array [0,1,2,3,0,1,2,2,3] and I want the first chunk of
non-decreasing values from this array (eg: In this case I want
[0,1,2,3])
Thanks,
Rajanikanth
Here is
On 10/9/08, Serge Matveenko [EMAIL PROTECTED] wrote:
I need to put in the var property of the first object from the list
that is not None. Somth like:
foo = first_of([any, beny, riki,]).name
Dont want to ugly if-cascade:
foo = any.name if name is not None else beny.name if beny is not None
Serge Matveenko schrieb:
On 10/9/08, Serge Matveenko [EMAIL PROTECTED] wrote:
I need to put in the var property of the first object from the list
that is not None. Somth like:
foo = first_of([any, beny, riki,]).name
Dont want to ugly if-cascade:
foo = any.name if name is not None else
Chris Rebert wrote:
I personally would probably do:
from collections import defaultdict
label2sum = defaultdict(lambda: 0)
FWIW, you can just use:
label2sum = defaultdict(int)
You don't need a lambda.
for r in rec:
for key, value in r.iteritems():
label2sum[key] += value
I tried to do this elegantly, but did not come up with a good solution
Sort strings like
foo1bar2
foo10bar10
foo2bar3
foo10bar2
So that they come out:
foo1bar2
foo2bar3
foo10bar2
foo10bar10
I.e. isolate integer parts and sort them according to integer value.
Thx
Holger
--
Dear all,
I have encountered this weird problem.
I have a class definition with an __init__ argument 'd'
which defaults to {}. This argument is put in the 'self.d'
attribute at initialization
I create two independent instances of this class; the code
is as follows.
class C:
def
hi All,
i have few lines in file
ttccatttctggacatgacgtctgt6901ggtttaagctttgtgaaagaatgtgctttgattcg
i need to replace the number and get only the alphabet in such a case what
should i do.
Can any body suggest me
--
Beema Shafreen
--
http://mail.python.org/mailman/listinfo/python-list
See Pitfall #5 on http://zephyrfalcon.org/labs/python_pitfalls.html
It also applies to dictionaries (and sets, any mutable object really).
On Thu, Oct 9, 2008 at 1:03 AM, kenneth [EMAIL PROTECTED] wrote:
Dear all,
I have encountered this weird problem.
I have a class definition with an
kenneth wrote:
the 'd' variable already contains the 'self.d' value of the first
instance and not the default argument {}.
Am I doing some stupid error, or this is a problem ?
No, it always contains the default argument because default values are
created just ONE TIME.
On 9 Okt., 09:41, Holger [EMAIL PROTECTED] wrote:
I tried to do this elegantly, but did not come up with a good solution
Sort strings like
foo1bar2
foo10bar10
foo2bar3
foo10bar2
So that they come out:
foo1bar2
foo2bar3
foo10bar2
foo10bar10
I.e. isolate integer parts and sort them
I just got an exception and the traceback wouldn't go all the
way to the statement that threw the exception. I found that out
by using the debugger.
Contrast the traceback:
http://tinyurl.com/5xglde
with the debugger output (notice the arrow pointing to the last
statement the traceback
Beema Shafreen wrote:
hi All,
i have few lines in file
ttccatttctggacatgacgtctgt6901ggtttaagctttgtgaaagaatgtgctttgattcg
i need to replace the number and get only the alphabet in such a case
what should i do.
Can any body suggest me
From the regular expression module, use re.sub like this:
On 8 Ott, 22:23, beginner [EMAIL PROTECTED] wrote:
Hi All,
I have a list of records like below:
rec=[{F1:1, F2:2}, {F1:3, F2:4} ]
Now I want to write code to find out the ratio of the sums of the two
fields.
One thing I can do is:
sum(r[F1] for r in rec)/sum(r[F2] for r in rec)
But
On Thu, Oct 9, 2008 at 1:39 AM, kenneth [EMAIL PROTECTED] wrote:
On Oct 9, 10:14 am, Christian Heimes [EMAIL PROTECTED] wrote:
kenneth wrote:
the 'd' variable already contains the 'self.d' value of the first
instance and not the default argument {}.
Am I doing some stupid error, or this
Steve Holden wrote:
Diez B. Roggisch wrote:
sa6113 wrote:
I couldn't find any good source for download Openssh on the net?
Would you please introduce a URL for download that?
http://www.vapor.com/amtelnet/
it supports only SSHv1, but I guess that's ok.
No, you really don't want to
Luis Zarrabeitia wrote:
But it doesn't say how to put the file object in non-blocking mode. (I was
trying to put the file object in non-blocking mode to test next()'s
behavior). ??Ideas?
# Some magic to make a file non blocking - from the internet
def unblock(f):
Given file 'f', sets its
I'm using SimpleXmlRpcServer class. Although I set encoding parameter in the
constructor, I have to return all strings in default platform encoding
(windows-1250/win32 or iso-8859-2/linux in my case). When I send values in,
for example, UTF-8, string received by client is messed up.
The client
FB:
def add_r( sums, r ): return sums[0]+r['F1'], sums[1]+r['F2']
sum_f1, sum_f2 = reduce( add_r, rec, (0,0) )
result = sum_f1/sum_f2
Until this feature vanishes I think it's better to use it (untested):
add_r = lambda (a, b), r: (a + r['F1'], b + r['F2'])
Bye,
bearophile
--
lookon Thank you for your help.It works. However, I am using Google
lookon App Engine and cannot import dateutil and epsilon.
I don't know how Google App Engine works, but are you not able to install
pure Python modules?
lookon Are there any other ways?
Take a look at the
Terry Reedy wrote:
Boris Borcic wrote:
...
- allowing containment tests, ie x in Number to invoke isinstance()
in the background when the container is of type type. My brain is
too muddled by flu at the moment, to see whether Guido's fabled time
machine allowed him to already provide all
Is there a canonical way to address the bits in a structure
like an array or string or struct?
Or alternatively, is there a good way to combine eight
ints that represent bits into one of the bytes in some
array or string or whatever?
It seems to me that there is a dilemma here :
if you can
Diez B. Roggisch-2 wrote:
shymon wrote:
I'm using SimpleXmlRpcServer class. Although I set encoding parameter in
the constructor, I have to return all strings in default platform
encoding
(windows-1250/win32 or iso-8859-2/linux in my case). When I send values
in, for example, UTF-8,
Joe Strout wrote:
Catching up on what's new in Python since I last used it a decade ago,
I've just been reading up on template strings. These are pretty cool!
However, just as a template string has some advantages over %
substitution for building a string, it seems like it would have
Joe templ = Template(The $object in $location falls mainly in the
$subloc.)
Joe d = templ.match(s)
Joe and then d would either by None (if s doesn't match), or a
Joe dictionary with values for 'object', 'location', and 'subloc'.
Joe But I couldn't find anything like
I have solved the problem. thank you
On Oct 9, 7:20 pm, [EMAIL PROTECTED] wrote:
lookon Thank you for your help.It works. However, I am using Google
lookon App Engine and cannot import dateutil and epsilon.
I don't know how Google App Engine works, but are you not able to install
On Oct 8, 4:04 pm, pepitovadecurt [EMAIL PROTECTED] wrote:
Hi I need to access to the Google Calendar under python.
Is posible?
Yes:
http://code.google.com/p/gdata-python-client/
Eli
--
http://mail.python.org/mailman/listinfo/python-list
lookon but can you tell me what format is it?
Read the strftime man page on your computer or Google for strftime or read
the Python docs about the time.strftime function. (strftime and strptime
strive to have the same set of format characters.)
Skip
--
Aaron Castironpi Brady a écrit :
Hello,
The 'inspect' module has this method:
inspect.getargvalues(frame)
It takes a frame and returns the parameters used to call it, including
the locals as defined in the frame, as shown.
def f( a, b, d= None, *c, **e ):
... import inspect
...
On 9 Okt., 10:57, Marc 'BlackJack' Rintsch [EMAIL PROTECTED] wrote:
On Thu, 09 Oct 2008 00:41:27 -0700, Holger wrote:
I tried to do this elegantly, but did not come up with a good solution
Sort strings like
foo1bar2
foo10bar10
foo2bar3
foo10bar2
So that they come out:
foo1bar2
I'm trying to get a simple multicast application working using
Twisted; so far I have:
from twisted.internet.protocol import DatagramProtocol
from twisted.internet import reactor
from twisted.application.internet import MulticastServer
class MulticastServerUDP(DatagramProtocol):
def
Tino Yeah, its a bit hard to spot:
Tino
http://docs.python.org/library/stdtypes.html#string-formatting-operations
That shows how to use the template formatting as it currently exists. To my
knowledge there is no support for the inverse operation, which is what Joe
asked about. Given
Hi,
Hendrik van Rooyen wrote:
Is there a canonical way to address the bits in a structure
like an array or string or struct?
Or alternatively, is there a good way to combine eight
ints that represent bits into one of the bytes in some
array or string or whatever?
It seems to me that there is
On Oct 9, 10:14 am, Christian Heimes [EMAIL PROTECTED] wrote:
kenneth wrote:
the 'd' variable already contains the 'self.d' value of the first
instance and not the default argument {}.
Am I doing some stupid error, or this is a problem ?
No, it always contains the default argument
Christian Heimes schrieb:
Thomas Heller wrote:
but this is very ugly, imo. Is there another way?
The raw_func instances that I have are not descriptors (they
do not implement a __get__() method...)
I've written PyInstanceMethod_Type for this use case. It's not (yet)
available for Python
Tim Chase wrote:
[In response t David Lyon]
My questions are:
- can most everyday vanilla linux web hosts run a django site ?
- can most everyday vanilla linux web hosts run python web scripts?
Depends on your definition of most everyday vanilla linux web hosts. :)
The
Diez B. Roggisch wrote:
Steve Holden wrote:
Diez B. Roggisch wrote:
sa6113 wrote:
I couldn't find any good source for download Openssh on the net?
Would you please introduce a URL for download that?
http://www.vapor.com/amtelnet/
it supports only SSHv1, but I guess that's ok.
No, you
Lawrence D'Oliveiro wrote:
Hendrik van Rooyen wrote:
import time
while True:
end_time = time.time() + 5
while time.time() end_time:
do_the_in_between_stuff()
do_the_every_five_second_stuff()
Maybe I'm dense, but ... where do you stop the
On Thu, 09 Oct 2008 00:41:27 -0700, Holger wrote:
I tried to do this elegantly, but did not come up with a good solution
Sort strings like
foo1bar2
foo10bar10
foo2bar3
foo10bar2
So that they come out:
foo1bar2
foo2bar3
foo10bar2
foo10bar10
I.e. isolate integer parts and sort
I am writing a package manager and stuck unable to write the version
sorting function the algorithm is here
http://www.linux.gr/cgi-bin/man/man2html?deb-version+5
and all other info is also in it please tell me how to do lexical
comparision in python it'll be cool if you just write the code!
--
Antti Kervinen wrote:
Hello!
aspects.py is a lightweight and low-level library for intercepting
function calls. Functions and methods (also in Python standard library
and third party code) can be wrapped so that when they are called, the
wrap is invoked first. Depending on the wrap, the
Joe Strout wrote:
Catching up on what's new in Python since I last used it a decade ago,
I've just been reading up on template strings. These are pretty cool!
However, just as a template string has some advantages over %
substitution for building a string, it seems like it would have
On Thu, 9 Oct 2008 06:03:44 -0700 (PDT), Stodge [EMAIL PROTECTED] wrote:
[snip]
class MulticastServerUDP(DatagramProtocol):
def startProtocol(self):
print 'Started Listening'
# Join a specific multicast group, which is the IP we will
respond to
Until Python 2.5, the exception object still uses ansi string. Thus,
in the following example:
f = open(u\u6d4b.log)
Suppose the file to open does not exist, the output message of the
exception maybe like:
[Errno 2] No such file or directory: u'\u6d4b.log'
This is not a clear message.
I
shymon wrote:
Diez B. Roggisch-2 wrote:
shymon wrote:
I'm using SimpleXmlRpcServer class. Although I set encoding parameter in
the constructor, I have to return all strings in default platform
encoding
(windows-1250/win32 or iso-8859-2/linux in my case). When I send values
in,
Pyparsing makes building expressions with named fields pretty easy.
from pyparsing import Word, alphas
wrd = Word(alphas)
templ = The + wrd(object) + in + wrd(location) + \
stays mainly in the + wrd(subloc) + .
tests = \
The rain in Spain stays mainly in the plain.
The snake in
Hi,
I was wondering...
Say we have a np.ndarray A of two dimensions (a grayscale image for
example). If we want to access x:2, y:3, we have to do A[3,2]. Why is
the order of x and y reversed?
This is reversed in Matlab too, because Matlab is a matrix package and
matrix are often used this way.
On Oct 9, 9:33 am, Jean-Paul Calderone [EMAIL PROTECTED] wrote:
On Thu, 9 Oct 2008 06:03:44 -0700 (PDT), Stodge [EMAIL PROTECTED] wrote:
[snip]
class MulticastServerUDP(DatagramProtocol):
def startProtocol(self):
print 'Started Listening'
# Join a specific multicast
[EMAIL PROTECTED] wrote:
Tino Yeah, its a bit hard to spot:
Tino
http://docs.python.org/library/stdtypes.html#string-formatting-operations
That shows how to use the template formatting as it currently exists. To my
knowledge there is no support for the inverse operation, which is
What is the best way to do the regular bash commands in native python?
- create directory
- create file
- make a symlink
- copy a file to another directory
- move a file
- set permissions
I need to write a program that creates real application/FTP accounts
and make regular backups to external
Hey,
I found it. Python rocks:
http://www.python.org/doc/2.5.2/lib/os-file-dir.html
If you have any further links that provide some lively code examples
and recipes, please pass them on.
Thank you
Frank Malina
http://vizualbod.com
--
http://mail.python.org/mailman/listinfo/python-list
On Oct 9, 2008, at 7:05 AM, [EMAIL PROTECTED] wrote:
Tino
http://docs.python.org/library/stdtypes.html#string-formatting-operations
That shows how to use the template formatting as it currently
exists. To my
knowledge there is no support for the inverse operation, which is
what Joe
On Oct 9, 10:13 am, Frantisek Malina [EMAIL PROTECTED] wrote:
Hey,
I found it. Python rocks:http://www.python.org/doc/2.5.2/lib/os-file-dir.html
If you have any further links that provide some lively code examples
and recipes, please pass them on.
Thank you
Frank
Joe Strout wrote:
Catching up on what's new in Python since I last used it a decade ago,
I've just been reading up on template strings. These are pretty
cool!
I don't think they've gained much traction and expect them to be superseded
by PEP 3101 (see
Tino ??? can you elaborate? I don't see the problem.
Tino %(foo)s % mapping
Joe wants to go in the other direction. Using your example, he wants a
function which takes a string and a template string and returns a dict.
Here's a concrete example:
s = My dog has fleas
fmt = My
I am using this code to connect to a windows machine using paramiko, I have
installed sshd on the machine and it works properly:
sock.connect((hostname, port))
t = paramiko.Transport(sock)
event = threading.Event()
t.start_client(event)
event.wait()
if not t.is_active():
print
hi,
Can someone help me i would like to run this program 3 times or more and would
like to append the cPickle file as a high score table keeping my top scores.
Right now it only records the last score thanks.
# Trivia Challenge
# Trivia game that reads a plain text file
def
Gary Herron wrote:
Beema Shafreen wrote:
hi All,
i have few lines in file
ttccatttctggacatgacgtctgt6901ggtttaagctttgtgaaagaatgtgctttgattcg
i need to replace the number and get only the alphabet in such a case
what should i do.
Can any body suggest me
From the regular expression module,
En Thu, 09 Oct 2008 00:24:20 -0300, Aaron Castironpi Brady
[EMAIL PROTECTED] escribió:
Found this bug. It's in 2.6, too bad.
Posting here is not going to help much, it just will be lost. Would be
better to file a bug report at http://bugs.python.org/
--
Gabriel Genellina
--
On 2008-10-08, pepitovadecurt [EMAIL PROTECTED] wrote:
Hi I need to access to the Google Calendar under python.
Odd. You'd think somebody who uses Google Calendar would know
how to use Google.
Is posible?
http://www.google.com/search?q=google+calendar+python
First hit.
--
Grant Edwards
but can you tell me what format is it?
in the str there is a float and I can not deal with it
On Oct 9, 7:20 pm, [EMAIL PROTECTED] wrote:
lookon Thank you for your help.It works. However, I am using Google
lookon App Engine and cannot import dateutil and epsilon.
I don't know how
Hello, everybody!
Could someone help me with coding this thing?
I need to put in the var property of the first object from the list
that is not None. Somth like:
foo = first_of([any, beny, riki,]).name
Dont want to ugly if-cascade:
foo = any.name if name is not None else beny.name if beny is
On Wed, Oct 8, 2008 at 9:14 PM, Martin v. Löwis [EMAIL PROTECTED] wrote:
The documentation for the ast module states that it helps to find out
programmatically what the current grammar looks like. I can't find
any reference (even when reading the code) on how you should go about
this, other
Serge Matveenko a écrit :
Hello, everybody!
Could someone help me with coding this thing?
I need to put in the var property of the first object from the list
that is not None. Somth like:
foo = first_of([any, beny, riki,]).name
Dont want to ugly if-cascade:
foo = any.name if name is not
The ast module in 2.6 has something...
On Thu, Oct 9, 2008 at 1:34 AM, Warren DeLano [EMAIL PROTECTED] wrote:
I would like to parse arbitrary insecure text string containing nested
Python data structures in eval-compatible form:
# For example, given a config.txt such as:
{
'my_atom' :
Hi I need to access to the Google Calendar under python.
Is posible?
--
http://mail.python.org/mailman/listinfo/python-list
shymon wrote:
I'm using SimpleXmlRpcServer class. Although I set encoding parameter in
the constructor, I have to return all strings in default platform encoding
(windows-1250/win32 or iso-8859-2/linux in my case). When I send values
in, for example, UTF-8, string received by client is
I would like to parse arbitrary insecure text string containing nested
Python data structures in eval-compatible form:
Python 2.6 has ast.literal_eval to do exactly this. It handle lists,
tuples, dict, numbers, strings, bool and None, with arbitrary nesting.
Cheers,
Franck
--
On Thu, 9 Oct 2008 06:37:04 -0700 (PDT), WaterWalk [EMAIL PROTECTED] wrote:
Until Python 2.5, the exception object still uses ansi string. Thus,
in the following example:
f = open(u\u6d4b.log)
Suppose the file to open does not exist, the output message of the
exception maybe like:
[Errno 2]
Catching up on what's new in Python since I last used it a decade ago,
I've just been reading up on template strings. These are pretty
cool! However, just as a template string has some advantages over %
substitution for building a string, it seems like it would have
advantages over
I need to put in the var property of the first object from the list
that is not None. Somth like:
foo = first_of([any, beny, riki,]).name
Dont want to ugly if-cascade:
foo = any.name if name is not None else beny.name if beny is not None \
else riki.name if riki is not None
assuming you
Thank you for your help.It works.
However, I am using Google App Engine and cannot import dateutil and
epsilon.
Are there any other ways?
On Oct 8, 10:06 pm, [EMAIL PROTECTED] wrote:
lookon I have two string like 2007-03-27T08:54:43+08:00 how do I get
lookon the hours between these
On 9 Ott, 09:41, Holger [EMAIL PROTECTED] wrote:
I tried to do this elegantly, but did not come up with a good solution
Sort strings like
foo1bar2
foo10bar10
foo2bar3
foo10bar2
So that they come out:
foo1bar2
foo2bar3
foo10bar2
foo10bar10
I.e. isolate integer parts and sort them
On Fri, 10 Oct 2008 00:30:18 +0200, Hendrik van Rooyen wrote:
Is there a canonical way to address the bits in a structure like an
array or string or struct?
Or alternatively, is there a good way to combine eight ints that
represent bits into one of the bytes in some array or string or
On Thu, 09 Oct 2008 13:26:17 +0100, Orestis Markou wrote:
The ast module in 2.6 has something...
in python 2.6, ast.literal_eval may be used to replace eval() for
literals. It does not accepts statements and function calls, i.e.:
a = set([1, 2, 3])
repr(a)
set([1, 2, 3])
Hi I am new to writing module and object oriented python code. I am
trying to understand namespaces and classes in python.
I have the following test case given in three files runner , master
and child. I am getting an error within child where in one line it
understands variable master.name and in
On Oct 9, 6:30 pm, Hendrik van Rooyen [EMAIL PROTECTED] wrote:
Is there a canonical way to address the bits in a structure
like an array or string or struct?
I don't know of a canonical way (bit hacking is not really common in
Python) but pehaps BitPacket [1] comes close to what you're after.
On 9 Ott, 17:43, harijay [EMAIL PROTECTED] wrote:
Hi I am new to writing module and object oriented python code. I am
trying to understand namespaces and classes in python.
I have the following test case given in three files runner , master
and child. I am getting an error within child where
Lie Ryan [EMAIL PROTECTED] writes:
in python 2.6, ast.literal_eval may be used to replace eval() for
literals.
What happens on literal_eval('[1]*9') ?
--
http://mail.python.org/mailman/listinfo/python-list
On Thu, Oct 9, 2008 at 11:43 AM, harijay [EMAIL PROTECTED] wrote:
Hi I am new to writing module and object oriented python code. I am
trying to understand namespaces and classes in python.
I have the following test case given in three files runner , master
and child. I am getting an error
Thanks beiff for your prompt reply - But I shouldnt need to import
master in child.
Actually and very strangely. The problem fixed itself without any
change to my code.
I dont understand how. It may have been a problem with a bad *.pyc
lingering around . But now I cannot get the old NameError to
Thanks Jerry and beiff ,
Jerry was right, it was an indent problem . Between using my text
editor and running from commandline something went out of sync and I
didnt catch it probably.
I can now reproduce the error with a bad ident .
These are my first posts to comp.lang.python..and I am very
Wow, this was harder than I thought (at least for a rusty Pythoneer
like myself). Here's my stab at an implementation. Remember, the
goal is to add a match method to Template which works like
Template.substitute, but in reverse: given a string, if that string
matches the template, then
On Oct 9, 3:22 pm, jdd [EMAIL PROTECTED] wrote:
On Oct 9, 10:13 am, Frantisek Malina [EMAIL PROTECTED] wrote:
Hey,
I found it. Python
rocks:http://www.python.org/doc/2.5.2/lib/os-file-dir.html
If you have any further links that provide some lively code examples
and recipes, please
Thanks for all of your replies.
Rajanikanth
On Wed, Oct 8, 2008 at 11:59 PM, beginner [EMAIL PROTECTED] wrote:
Hi,
On Oct 8, 6:36 pm, Rajanikanth Jammalamadaka [EMAIL PROTECTED]
wrote:
Hi!
Is there a functional way to do this?
I have an array [0,1,2,3,0,1,2,2,3] and I want the first
Hi,
I'm using Windows XP and I'm looking for way out to remove .svn folders from
my directory. But I'm unable to do that.
Does any one one has written any script for removing the hidden / readonly
files or directories?
Regards,
Rajat
--
http://mail.python.org/mailman/listinfo/python-list
pepitovadecurt wrote:
Hi I need to access to the Google Calendar under python.
Is posible?
You mean this?
http://code.google.com/apis/calendar/developers_guide_python.html
j
--
http://mail.python.org/mailman/listinfo/python-list
Kent Johnson wrote:
On Oct 8, 5:55 pm, gigs [EMAIL PROTECTED] wrote:
Benjamin wrote:
On Oct 8, 12:49 pm, Bruno [EMAIL PROTECTED] wrote:
Hi!
I have big .txt file which i want to read, process and write to another .txt
file.
I have done script for that, but im having problem with croatian
On Mon, 06 Oct 2008 00:14:37 -0700, process wrote:
On Oct 6, 8:13 am, Aidan [EMAIL PROTECTED] wrote:
process wrote:
I am trying to solve project euler problem 18 with brute force(I will
move on to a better solution after I have done that for problem 67).
* Lawrence D'Oliveiro (Wed, 08 Oct 2008 10:47:54 +1300)
In message [EMAIL PROTECTED], Thorsten
Kampe wrote:
* Lawrence D'Oliveiro (Mon, 06 Oct 2008 23:18:10 +1300)
In message [EMAIL PROTECTED], Thorsten
Kampe wrote:
* Lawrence D'Oliveiro (Sun, 05 Oct 2008 22:13:46 +1300)
In message
* Mensanator (Tue, 7 Oct 2008 10:58:24 -0700 (PDT))
On Oct 7, 12:40 pm, Thorsten Kampe [EMAIL PROTECTED] wrote:
* Lawrence D'Oliveiro (Mon, 06 Oct 2008 23:18:10 +1300)
In message [EMAIL PROTECTED], Thorsten Kampe
wrote:
* Lawrence D'Oliveiro (Sun, 05 Oct 2008 22:13:46 +1300)
In
Many pills in the market today like Ecstasy are popular at rave
parties. These pills though effective in giving you a kick can also be
risky to consume possess. Reactions to these drugs include teeth
gritting, nausea, hazy vision, chills, spasms sweating. Increased
heart rate high BP levels
On Oct 9, 12:36 pm, Thorsten Kampe [EMAIL PROTECTED] wrote:
* Mensanator (Tue, 7 Oct 2008 10:58:24 -0700 (PDT))
On Oct 7, 12:40 pm, Thorsten Kampe [EMAIL PROTECTED] wrote:
* Lawrence D'Oliveiro (Mon, 06 Oct 2008 23:18:10 +1300)
In message [EMAIL PROTECTED], Thorsten Kampe
wrote:
I've written a port forwarding wrapper with paramiko for an app we use
and it works fine except that it consumes way too much processor.
(i.e. 25% +) I'm trying to write a stackless-based server class to
replace the threading one but I can't get the tunnel the wrapper
creates to work for more
On Oct 9, 5:30 pm, Hendrik van Rooyen [EMAIL PROTECTED] wrote:
Is there a canonical way to address the bits in a structure
like an array or string or struct?
Or alternatively, is there a good way to combine eight
ints that represent bits into one of the bytes in some
array or string or
Hi Terry,
Thanks for your reply. But the reason I want to have that is for not
changing the functions which already based on translation functions.
If there is any idea how to bring parameter in static method, that will be
great.
Wei
On Wed, Oct 8, 2008 at 8:24 PM, Terry Reedy [EMAIL PROTECTED]
You might also be interested in the 'shutil' module:
http://docs.python.org/library/shutil.html#module-shutil
Cheers,
Chris
--
Follow the path of the Iguana...
http://rebertia.com
On Thu, Oct 9, 2008 at 7:13 AM, Frantisek Malina [EMAIL PROTECTED] wrote:
Hey,
I found it. Python rocks:
kenneth a écrit :
On Oct 9, 10:14 am, Christian Heimes [EMAIL PROTECTED] wrote:
kenneth wrote:
the 'd' variable already contains the 'self.d' value of the first
instance and not the default argument {}.
Am I doing some stupid error, or this is a problem ?
No, it always contains the default
On Oct 9, 9:01 am, Paul Rubin http://[EMAIL PROTECTED] wrote:
Lie Ryan [EMAIL PROTECTED] writes:
in python 2.6, ast.literal_eval may be used to replace eval() for
literals.
What happens on literal_eval('[1]*9') ?
The documentation clearly states that it will fail to evaluate and
1 - 100 of 231 matches
Mail list logo
