Re: while True or while 1
On Sun, Dec 12, 2010 at 3:14 PM, Max Countryman wrote: > I'm sure this has been brought up many times, but a quick Googling didn't > yield the decisive results I was hoping for, so I apologize if this has > already been addressed in great detail somewhere else. > > I am wondering what the rationale is behind preferring while True over while > 1? For me, it seems that using True provides more clarity, but is that the > only benefit? Is while 1 more prone to errors? It's just silly to use 1 since it will evaluate to True either way. -- http://mail.python.org/mailman/listinfo/python-list
Re: HTMLWindow or HtmlWindow or perhaps HTMLwindo
On Mon, Nov 15, 2010 at 9:09 PM, Ben James wrote: > On 15/11/2010 19:53, Boštjan Mejak wrote: >> >> Hello, I am wondering which of the 3 class names are prefered by PEP-8? >> >> class HTMLWindow(...) >> >> class HtmlWindow(...) >> >> class HTMLwindow(...) >> >> >> Thank you for your answer in advance. > > PEP 8 says: > > Note: When using abbreviations in CapWords, capitalize all the > letters of the abbreviation. Thus HTTPServerError is better than > HttpServerError. > > So, to apply that to your example, PEP 8 recommends HTMLWindow. > -- > http://mail.python.org/mailman/listinfo/python-list > Yeah, since HTML is an abbreviation it's the exact recommendation to use... :) -- http://mail.python.org/mailman/listinfo/python-list
Re: HTMLWindow or HtmlWindow or perhaps HTMLwindo
""" CapitalizedWords (or CapWords, or CamelCase -- so named because of the bumpy look of its letters[4]). This is also sometimes known as StudlyCaps. Note: When using abbreviations in CapWords, capitalize all the letters of the abbreviation. Thus HTTPServerError is better than HttpServerError. """ On Mon, Nov 15, 2010 at 8:53 PM, Boštjan Mejak wrote: > Hello, I am wondering which of the 3 class names are prefered by PEP-8? > > class HTMLWindow(...) > > class HtmlWindow(...) > > class HTMLwindow(...) > > > Thank you for your answer in advance. > -- > http://mail.python.org/mailman/listinfo/python-list > -- http://mail.python.org/mailman/listinfo/python-list
Re: Silly newbie question - Carrot character (^)
On Fri, Nov 5, 2010 at 2:43 PM, Matty Sarro wrote: > Hey Everyone, > Just curious - I'm working on a program which includes a calculation of a > circle, and I found myself trying to use pi*radius^2, and getting errors > that data types float and int are unsupported for "^". Now, I realized I was > making the mistake of using '^' instead of "**". I've corrected this and its > now working. However, what exactly does ^ do? I know its used in regular > expressions but I can't seem to find anything about using it as an operator. > Sadly my google foo is failing since the character gets filtered out. It's a binary operator i think... something like xor. -- http://mail.python.org/mailman/listinfo/python-list
Re: How i can get data from an image
You should check out OpenCV. On Tue, Oct 26, 2010 at 8:53 PM, Kechagias Apostolos wrote: > Hello there. > I ve been using python a lot lately for my school in order to make small > gui(wxpython) apps. > Today a teacher came up with an interesting project. > The idea is that he gives you a series of photos with some objects inside. > For example a photo could contain two black circles in a white background. > The question is how can i find a circle in a given image? > When i find the circles how can i draw a line between them in order to > create a connection? > I know that this may need pattern recognition. > What i want you to tell me is what things i will need in order to make this > thing possible with python. > My idea is to use use PIL in order to find the circles in the image. > Then i will import this image to wxpython canvas and i will draw a line > between their centers. > Is that possible? > I really need some help here. > -- > http://mail.python.org/mailman/listinfo/python-list > > -- http://mail.python.org/mailman/listinfo/python-list
Re: C++ vs. Python Was: Re: help!!!
On Wed, Oct 6, 2010 at 12:16 PM, Hans-Peter Jansen wrote: > On Wednesday 06 October 2010, 06:28:51 Dennis Lee Bieber wrote: >> On Tue, 05 Oct 2010 23:54:00 -0400, >> >> declaimed the following in gmane.comp.python.general: >> > plz can u convert this cpp file into python i need that badly as soon >> > as possible... I am new to python. I just wanna learn it >> >> Step one... DON'T TRY TO PORT C++ to Python... the object models are >> quite different. > > I do this all the time without any adverse effects (other than being glad to > only rarely having the need of doing it the other way around ;-)). I have on occasion translated a few algorithms from python to c++ and only needed to spend minimal time pythonize the code. Generally I believe that porting from python to c++ and the other way around can be done pretty nicely but you always have to take care to restructure what has to be restructured. -- http://mail.python.org/mailman/listinfo/python-list
Re: 3D cube navigation
On Fri, Sep 10, 2010 at 9:10 PM, sahilsk wrote: > hi, i need to make a 3d cube as a navigation menu.. each face having > separate button .. or effect. > any idea, how can i make one such 3D figures with functionality of > mouse events? In what environment, what toolkit, for what purpose? -- http://mail.python.org/mailman/listinfo/python-list
Re: How to determine if a Python script is being run right after startup on Windows
On Tue, Sep 7, 2010 at 11:43 AM, Dennis Verdonschot wrote: > Hi Ryan, > > Maybe I'm missing something, but wouldn't creating a shortcut and > putting that shortcut in your Start - Programs - Startup section of > the Windows menu not work for this program? Or if really needed you > can edit the start-up programs in the registry. > > If you add some logging ability to your program you can verify it has > been run and you can still use commandline arguments by changing the > shortcut. > > -- > Dennis > -- > http://mail.python.org/mailman/listinfo/python-list > I would recommend using a commandline switch (look at sys.argv in documentation) and just start the script with something like python script.py --change-wallpaper or maybe require a switch for getting to the GUI... -- http://mail.python.org/mailman/listinfo/python-list
Re: Stackless Python and EVE Online
On Tue, Aug 31, 2010 at 5:10 PM, Benjamin Kaplan wrote: > On Tuesday, August 31, 2010, Roman Sokolyuk wrote: >> Hi, >> >> I am new to Python and I wanted to understand something... >> The EVE Online Client is build using Stackless Python >> So when I install the client on my machine, how doe sit get run if I do not >> have Python installed? >> > We call it "freezing" the program. There are several tools that do > this with py2exe being the most popular. These tools create an > executable that includes a bundled python interpreter along with all > the scripts and modules needed to run the program. >> Thanks. > -- > http://mail.python.org/mailman/listinfo/python-list > I'm not sure but I do believe it is mainly the servers that are written in stackless... -- http://mail.python.org/mailman/listinfo/python-list
Re: creating addon system
On Fri, May 21, 2010 at 5:50 PM, timo verbeek wrote:
> What is the easiest way in python to create a addon system?
> I found to easy ways:
> * using a import system like this:
> for striper in stripers:
> if striper["enabled"]:
> exec("from strip import %s as _x"%striper["striper"])
> string = _x.start(string)
> * using exec
> for striper in stripers:
> if striper["enabled"]:
> use=open(stripper)
> exec(use)
>
> Do you now is the best way?
> --
> http://mail.python.org/mailman/listinfo/python-list
>
Check this one out: http://docs.python.org/library/functions.html#__import__
--
http://mail.python.org/mailman/listinfo/python-list
Re: Global variables for python applications
On Sun, May 16, 2010 at 7:50 PM, AON LAZIO wrote: > Hi, > How can I set up global variables for the entire python applications? > Like I can call and set this variables in any .py files. > Think of it as a global variable in a single .py file but this is for the > entire application. > Thanks > > -- > Aonlazio > 'Peace is always the way.' NW First: Do NOT use global variables, it is bad practice and will eventually give you loads of s**t. But if you want to create global variables in python I do believe it is possible to specify them in a .py file and then simply import it as a module in your application. If you change one value in a module the change will be available in all places you imported that module in. -- http://mail.python.org/mailman/listinfo/python-list
Re: Need help in python plug-in development
On Wed, Apr 28, 2010 at 12:21 PM, Suraj Sakhare wrote: > Hi, I am new to python. I am using python 2.6. I have gone through the > basic python and now I am trying to develop some plugin for maya 2009 > through python. So, for that I would need helping hand. You would have to ask questions for that... just so you know. -- http://mail.python.org/mailman/listinfo/python-list
Re: any modules having a function to partition a list by predicate provided?
On Tue, Apr 20, 2010 at 3:40 AM, segunai wrote: > On 4월20일, 오전10시16분, Chris Rebert wrote: >> On Mon, Apr 19, 2010 at 6:00 PM, knifenomad wrote: >> > i know it's not very hard to get that solution. >> > just by implementing simple function like below. >> >> > def partition(target, predicate): >> >""" >> >split a list into two partitions with a predicate >> > provided. >> >any better ideas? :) >> >""" >> >true = [] >> >false= [] >> >for item in target: >> >if predicates(item): >> >true.append(item) >> >else: >> >false.append(item) >> >return true, false >> >> > but i wonder if there's another way to do this with standard libraries >> > or .. built-ins. >> > if it's not, i'd like the list objects to have partition method like >> > string module has. >> >> (A) str.partition() has a /completely/ different meaning from your >> partition() >> (B) You'd probably have better luck getting it added to the itertools >> module since the concept is applicable to all iterables. >> [http://docs.python.org/library/itertools.html] >> >> Cheers, >> Chris >> --http://blog.rebertia.com > > yep, my mistake. i shouldn't have compared it to string's partition(). > i just wanted that convenience string.partition() has as a built-in. > anyway, thanks for itertools. :) > -- > http://mail.python.org/mailman/listinfo/python-list > The way I would do it is probably apply filter to the list: >>> def f(x): return x % 2 != 0 and x % 3 != 0 ... >>> filter(f, range(2, 25)) [5, 7, 11, 13, 17, 19, 23] -- http://mail.python.org/mailman/listinfo/python-list
Re: Python Learning Environment
On Sat, Apr 17, 2010 at 7:06 PM, Vijay Shanker Dubey wrote: > Yes you are right about symlink thing. > So what should I do for a clever developer environment? > Should I change that python link to python3 or python3.1? > > Regards, > Vijay Shanker Dubey > It all depends on what you want to do. I would say that you shouldn't change your python link at all, if you want to run a python script using 3.1 just call the script using python3 as an interpreter. -- http://mail.python.org/mailman/listinfo/python-list
Re: Python Learning Environment
On Sat, Apr 17, 2010 at 6:32 PM, Vijay Shanker Dubey wrote: > Hi, > My Linux box is ubuntu system. I want to create a development environment on > my system for python programing language. I got to see there are two > versions of python language > 1. python 2.5.6 > 2. python 3.1.2 > To find out what version i look in to my "/usr/bin" folder. There are many > entries for python command > - python > - python2 > - python2.5 > - python2.6 > - python3 > - python3.1 > what does this mean? I am able to run run my first program with all these > command. should i remove all these and have the latest one? I am confused > about these finding. Is this okay to have these all? > > Regards, > Vijay Shanker Dubey > python is symlinked to one of the 2.5, 2.6 or 3.1... most probably 2.6. The python2 is symlink to one of 2.5 or 2.6 and python3 is symlinked to python3.1. It's a clever way to be able to specify what version is needed for a script. -- http://mail.python.org/mailman/listinfo/python-list
Re: How to run python without python
On Fri, Apr 2, 2010 at 1:36 AM, Spencer wrote: > Is there a way to developing a script on linux and give it > to someone on microsoft, so that they could run it on microsoft > without installing python? > > Wayne > > -- > http://mail.python.org/mailman/listinfo/python-list > Short answer: No. -- http://mail.python.org/mailman/listinfo/python-list
Re: OT: Meaning of "monkey"
On Mon, Mar 29, 2010 at 3:09 PM, djc wrote: > Mensanator wrote: >> On Mar 26, 2:44 pm, Phlip wrote: >>> On Mar 26, 6:14 am, Luis M. González wrote: >>> Webmonkey, Greasemonkey, monkey-patching, Tracemonkey, Jägermonkey, Spidermonkey, Mono (monkey in spanish), codemonkey, etc, etc, etc... Monkeys everywhere. Sorry for the off topic question, but what does "monkey" mean in a nerdy-geek context?? Luis >>> Better at typing than thinking. >> >> Really? I thought it was more of a reference to Eddington, i.e., given >> enough time even a monkey can type out a program. > > > Precisely, given infinite typing and zero thinking... > > Note also the expression 'talk to the organ grinder not the monkey' > > and 'a trained monkey could do it' > > and then there are monkey wrenches, and monkey bikes... > > and never call the Librarian a monkey > The monkeys comes from different places... for example: "The term monkey patch was first used as guerrilla patch, [...], which was referred to as the patches engaging in battle with each other. Since the word guerrilla and gorilla are near-homophones, people started using the incorrect term gorilla patch instead of guerrilla patch. When a developer then created a guerrilla patch they tried very hard to avoid any battles that may ensue due to the patch and the term monkey patch was coined to make the patch sound less forceful." And then there is, as said, monkey wrenches which is utility tools. Codemonkeys, i believe, comes from the infinite monkeys theory. -- http://mail.python.org/mailman/listinfo/python-list
Re: Problem with sys.path when embedding Python3 in C
On Tue, Mar 23, 2010 at 8:07 AM, Gabriel Genellina
wrote:
> En Mon, 22 Mar 2010 18:19:49 -0300, Krister Svanlund
> escribió:
>
>> Hi, I've recently begun experimenting with embedding python and i got
>> a small problem.
>>
>> The following line here is the ugly-hack I had to do to make it work,
>> nothing else I know of makes it possible to import modules from
>> startup directory. So my question is: Is there a prettier way to do
>> this?
>
> The startup directory is not included in the module search path - neither in
> your embedded version, nor in the standard interpreter (it's only included
> when running in interactive mode).
>
>>> PyRun_SimpleString("import sys\nsys.path.append(\"\")");
>
> If you really want the current directory in sys.path, use the getcwd
> function to obtain it. But make sure this is what you want - the directory
> containing the executable might be a better choice (at least more
> predictable).
> Note that Python already provides lots of ways to add directories to
> sys.path (the default search path (see site.py), per-user site directories
> (see PEP370), .pth files, the PYTHONPATH and PYTHONHOME environment
> variables, the Windows registry, other ways I forgot...) So I'd ask why do
> you want to add a non-standard one.
>
> In C code, you can alter the initial search path by setting
> Py_SetProgramName and Py_SetPythonHome. And you may even completely replace
> getpathp.c source file with your own.
>
> --
> Gabriel Genellina
>
> --
> http://mail.python.org/mailman/listinfo/python-list
>
The thing is that I want the application to be able to import modules
I've written, but yeah, the applications directory is what I want
rather than the cwd. I have tried Py_SetProgramName but haven't gotten
it to work or cause any change at all to the import behaviour. Could
you possibly provide som sort of example?
--
http://mail.python.org/mailman/listinfo/python-list
Problem with sys.path when embedding Python3 in C
Hi, I've recently begun experimenting with embedding python and i got
a small problem.
This is my current testing code (basically all from python docs):
> int main(int argc, char *argv[])
>
> {
>
> PyObject *pModuleName, *pTestModule, *pTestFunc, *pTestResult, *pTestArgs;
>
> PyImport_AppendInittab("node", &PyInit_node);
>
> Py_Initialize();
The following line here is the ugly-hack I had to do to make it work,
nothing else I know of makes it possible to import modules from
startup directory. So my question is: Is there a prettier way to do
this?
> PyRun_SimpleString("import sys\nsys.path.append(\"\")");
>
> PyRun_SimpleString("import sys\nprint(sys.path)");
>
> pModuleName = PyUnicode_FromString("stuff");
>
> pTestModule = PyImport_Import(pModuleName);
>
> Py_DECREF(pModuleName);
>
> if (pTestModule != NULL)
>
> { ...
The whole code is here: http://pastebin.com/805BSY8f
You only need a file in the same directory called stuff.py containing
a function def for a function called do_stuff
--
http://mail.python.org/mailman/listinfo/python-list
Re: [python3]
On Fri, Mar 19, 2010 at 6:42 PM, Kevin Adams wrote: > Greetings! > > Please forgive me if im posting this to the wrong group. > > I'm new to Python, learning Python3 from the O'rielly "Learning > Python" book. Reading > about operator overloading, specifically __getitem__. I put together > a small bit of code to > do some experimenting and threw in a timer so i can see it do its > thing. For some reason > the time.sleep(x) function doesnt work when my print function includes > "end=''". > > Thanks in advance for any help. > > > ---code--- > > class TestClass(): > def __init__(self): > self.data = "I was far from home and the spell of the eastern > sea was upon me." > > def __getitem__(self,i): > return self.data[i] > > > import time > > if __name__ == "__main__": > > me = TestClass() > for x in me: > print(x,end='') #if i remove the 'end=''' it performs as i'd > expect > time.sleep(int(2)) > > -- > http://mail.python.org/mailman/listinfo/python-list > I'm guessing wildly here but I think you have to flush the output. Can't remember how right now but it won't take much googling for it. -- http://mail.python.org/mailman/listinfo/python-list
Re: When will Python go mainstream like Java?
On Tue, Feb 23, 2010 at 1:01 AM, Edward A. Falk wrote: > You mean it's not? > > -- > -Ed Falk, f...@despams.r.us.com > http://thespamdiaries.blogspot.com/ Javas popularity was very much a product of its time. It was something new and exciting and people got a bit too excited maybe, Python just does the same thing but better really, therefor it will not become as popular. -- http://mail.python.org/mailman/listinfo/python-list
Re: When will Python go mainstream like Java?
On Mon, Feb 22, 2010 at 10:56 PM, AON LAZIO wrote: > That will be superb > > -- > Passion is my style And when will be as famous as the beatles? -- http://mail.python.org/mailman/listinfo/python-list
Re: What's Going on between Python and win7?
On Mon, Feb 22, 2010 at 4:22 PM, W. eWatson wrote: > Last night I copied a program from folder A to folder B. It inspects the > contents of files in a folder. When I ran it in B, it gave the results for > A! Out of frustration I changed the name in A, and fired up the program in > B. Win7 went into search mode for the file. I looked at properties for the B > program, and it was clearly pointing to folder A. > > Anyone have this happen to them? > > Another anomaly. I have the files track.py and trackstudy.py in the same > folder along with 100 or so other py and txt data files. When I did a search > from the folder window in the upper right corner, search only found one of > the two. I called HP tech support about it, and they could see it for > themselves via remote control. They had no idea, but agreed to contact MS. > In this case, I noted that this search box has some sort of filter > associated with it. Possibly, in my early stages of learning to navigate in > Win7, I accidentally set the filter. > > Comments? I can't really see the python related problem here... -- http://mail.python.org/mailman/listinfo/python-list
Re: Is there a way to continue after an exception ?
On Sun, Feb 21, 2010 at 12:52 AM, Stef Mientki wrote: > hello, > > I would like my program to continue on the next line after an uncaught > exception, > is that possible ? > > thanks > Stef Mientki > Yes, you catch the exception and do nothing. -- http://mail.python.org/mailman/listinfo/python-list
Re: if not global -- then what?
On Sat, Feb 20, 2010 at 8:25 PM, egasimus wrote: > Hi, newbie here. I've read on using the 'global' keyword being > discouraged; then what is the preferred way to have something, for > example a class containing program settings, accessible from > everywhere, in a program spanning multiple files? > -- > http://mail.python.org/mailman/listinfo/python-list > There is probably a smarter way but I would recommend passing a settings object around. -- http://mail.python.org/mailman/listinfo/python-list
Re: Question about getmtime
On Fri, Feb 19, 2010 at 5:05 PM, Brandon wrote: > Hi everyone, > > Does copying or moving a file affect the return value of > os.path.getmtime(path)? > > Thank you, > Brandon Wouldn't it be easier to make a script and see for yourself then to write a mail about it? -- http://mail.python.org/mailman/listinfo/python-list
Re: Executing Python code on another computer
On Fri, Feb 19, 2010 at 4:52 PM, SiWi wrote: > Hello community, > I googled for an answer of the following problem, but I couldn't find > anything. > I've got a netbook and my fast workstation compter, which I usually > use for developing. > But I'd also like to take my netbook around the house and to develop > Python programms on it. > The problem is that naturally a netbook is not the fastest computer > you could find. > > So I wondered if it was possible to send the Python code I'm > developing on the netbook to the workstation pc via wlan, let the > script execute on the workstation pc and write the output back on the > netbook. > > Is there any possibilty to achieve that goal? > -- > http://mail.python.org/mailman/listinfo/python-list > I recommend setting up a SSH server on your stationary and run something like emacs. It's how I'm doing it anyway. -- http://mail.python.org/mailman/listinfo/python-list
Re: Function attributes
On Wed, Feb 10, 2010 at 2:59 PM, Muhammad Alkarouri wrote: > Hi everyone, > > What is the simplest way to access the attributes of a function from > inside it, other than using its explicit name? > In a function like f below: > > def f(*args): > f.args = args > print args > > is there any other way? > I am guessing the next question will be: should I really care? It just > feels like there should be a way, but I am not able to verbalise a > valid one at the moment, sorry. > > Regards, > > Muhammad Alkarouri > -- > http://mail.python.org/mailman/listinfo/python-list > This sounds like something you shouldn't be doing. You should probably use a class instead. (Sending again to get it on the list >_<) -- http://mail.python.org/mailman/listinfo/python-list
Re: Need help with a program
On Thu, Jan 28, 2010 at 4:31 PM, Krister Svanlund
wrote:
> On Thu, Jan 28, 2010 at 4:28 PM, Krister Svanlund
> wrote:
>> On Thu, Jan 28, 2010 at 4:07 PM, evilweasel
>> wrote:
>>> Hi folks,
>>>
>>> I am a newbie to python, and I would be grateful if someone could
>>> point out the mistake in my program. Basically, I have a huge text
>>> file similar to the format below:
>>>
>>> AGACTCGAGTGCGCGGA 0
>>> AGATAAGCTAATTAAGCTACTGG 0
>>> AGATAAGCTAATTAAGCTACTGGGTT 1
>>> AGCTCACAATAT 1
>>> AGGTCGCCTGACGGCTGC 0
>>>
>>> The text is nothing but DNA sequences, and there is a number next to
>>> it. What I will have to do is, ignore those lines that have 0 in it,
>>> and print all other lines (excluding the number) in a new text file
>>> (in a particular format called as FASTA format). This is the program I
>>> wrote for that:
>>>
>>> seq1 = []
>>> list1 = []
>>> lister = []
>>> listers = []
>>> listers1 = []
>>> a = []
>>> d = []
>>> i = 0
>>> j = 0
>>> num = 0
>>>
>>> file1 = open(sys.argv[1], 'r')
>>> for line in file1:
>>> if not line.startswith('\n'):
>>> seq1 = line.split()
>>> if len(seq1) == 0:
>>> continue
>>>
>>> a = seq1[0]
>>> list1.append(a)
>>>
>>> d = seq1[1]
>>> lister.append(d)
>>>
>>>
>>> b = len(lister)
>>> for j in range(0, b):
>>> if lister[j] == 0:
>>> listers.append(j)
>>> else:
>>> listers1.append(j)
>>>
>>>
>>> print listers1
>>> resultsfile = open("sequences1.txt", 'w')
>>> for i in listers1:
>>> resultsfile.write('\n>seq' + str(i) + '\n' + list1[i] + '\n')
>>>
>>> But this isn't working. I am not able to find the bug in this. I would
>>> be thankful if someone could point it out. Thanks in advance!
>>>
>>> Cheers!
I'm trying this again:
newlines = []
with open(sys.argv[1], 'r') as f:
text = f.read();
for line in (l.strip() for l in text.splitlines()):
if line:
line_elem = line.split()
if len(line_elem) == 2 and line_elem[1] == '1':
newlines.append('seq'+line_elem[0])
with open(sys.argv[2], 'w') as f:
f.write('\n'.join(newlines))
--
http://mail.python.org/mailman/listinfo/python-list
Re: Need help with a program
On Thu, Jan 28, 2010 at 4:28 PM, Krister Svanlund
wrote:
> On Thu, Jan 28, 2010 at 4:07 PM, evilweasel
> wrote:
>> Hi folks,
>>
>> I am a newbie to python, and I would be grateful if someone could
>> point out the mistake in my program. Basically, I have a huge text
>> file similar to the format below:
>>
>> AGACTCGAGTGCGCGGA 0
>> AGATAAGCTAATTAAGCTACTGG 0
>> AGATAAGCTAATTAAGCTACTGGGTT 1
>> AGCTCACAATAT 1
>> AGGTCGCCTGACGGCTGC 0
>>
>> The text is nothing but DNA sequences, and there is a number next to
>> it. What I will have to do is, ignore those lines that have 0 in it,
>> and print all other lines (excluding the number) in a new text file
>> (in a particular format called as FASTA format). This is the program I
>> wrote for that:
>>
>> seq1 = []
>> list1 = []
>> lister = []
>> listers = []
>> listers1 = []
>> a = []
>> d = []
>> i = 0
>> j = 0
>> num = 0
>>
>> file1 = open(sys.argv[1], 'r')
>> for line in file1:
>> if not line.startswith('\n'):
>> seq1 = line.split()
>> if len(seq1) == 0:
>> continue
>>
>> a = seq1[0]
>> list1.append(a)
>>
>> d = seq1[1]
>> lister.append(d)
>>
>>
>> b = len(lister)
>> for j in range(0, b):
>> if lister[j] == 0:
>> listers.append(j)
>> else:
>> listers1.append(j)
>>
>>
>> print listers1
>> resultsfile = open("sequences1.txt", 'w')
>> for i in listers1:
>> resultsfile.write('\n>seq' + str(i) + '\n' + list1[i] + '\n')
>>
>> But this isn't working. I am not able to find the bug in this. I would
>> be thankful if someone could point it out. Thanks in advance!
>>
>> Cheers!
>
> I'm not totaly sure what you want to do but try this (python2.6+):
>
> newlines = []
>
> with open(sys.argv[1], 'r') as f:
> text = f.read();
> for line in text.splitlines():
> if not line.strip() and line.strip().endswith('1'):
newlines.append('seq'+line.strip()[:-1].strip())
>
> with open(sys.argv[2], 'w') as f:
> f.write('\n'.join(newlines))
>
Gah, made some errors
--
http://mail.python.org/mailman/listinfo/python-list
Re: Need help with a program
On Thu, Jan 28, 2010 at 4:07 PM, evilweasel
wrote:
> Hi folks,
>
> I am a newbie to python, and I would be grateful if someone could
> point out the mistake in my program. Basically, I have a huge text
> file similar to the format below:
>
> AGACTCGAGTGCGCGGA 0
> AGATAAGCTAATTAAGCTACTGG 0
> AGATAAGCTAATTAAGCTACTGGGTT 1
> AGCTCACAATAT 1
> AGGTCGCCTGACGGCTGC 0
>
> The text is nothing but DNA sequences, and there is a number next to
> it. What I will have to do is, ignore those lines that have 0 in it,
> and print all other lines (excluding the number) in a new text file
> (in a particular format called as FASTA format). This is the program I
> wrote for that:
>
> seq1 = []
> list1 = []
> lister = []
> listers = []
> listers1 = []
> a = []
> d = []
> i = 0
> j = 0
> num = 0
>
> file1 = open(sys.argv[1], 'r')
> for line in file1:
> if not line.startswith('\n'):
> seq1 = line.split()
> if len(seq1) == 0:
> continue
>
> a = seq1[0]
> list1.append(a)
>
> d = seq1[1]
> lister.append(d)
>
>
> b = len(lister)
> for j in range(0, b):
> if lister[j] == 0:
> listers.append(j)
> else:
> listers1.append(j)
>
>
> print listers1
> resultsfile = open("sequences1.txt", 'w')
> for i in listers1:
> resultsfile.write('\n>seq' + str(i) + '\n' + list1[i] + '\n')
>
> But this isn't working. I am not able to find the bug in this. I would
> be thankful if someone could point it out. Thanks in advance!
>
> Cheers!
I'm not totaly sure what you want to do but try this (python2.6+):
newlines = []
with open(sys.argv[1], 'r') as f:
text = f.read();
for line in text.splitlines():
if not line.strip() and line.strip().endswith('1'):
newlines.append('seq'+line)
with open(sys.argv[2], 'w') as f:
f.write('\n'.join(newlines))
--
http://mail.python.org/mailman/listinfo/python-list
Re: Default path for files
On Sun, Jan 24, 2010 at 4:08 PM, Rotwang wrote: > Hi all, can anybody tell me whether there's a way to change the default > location for files to be opened by open()? I'd like to be able to create > files somewhere other than my Python folder without having to write the full > path in the filename every time. Sorry if this is a stupid question, I don't > know much about programming. Check out http://docs.python.org/library/os.html and the function chdir it is what you are looking for. -- http://mail.python.org/mailman/listinfo/python-list
Re: Is python not good enough?
Every language has it uses and Google obviously thought that it would take more resources to get Python to the level they need it than to start using Go. Python is great for alot of things but it's not perfect for anything. On Tue, Jan 12, 2010 at 4:09 PM, ikuta liu wrote: > I'm a little confused. > Is python not good enough? > for google, enhance python performance is the good way better then > choose build Go language? > > Go language try to merge low level, hight level and browser language. > > Those I'd like to see it on python.. > -- > http://mail.python.org/mailman/listinfo/python-list > -- http://mail.python.org/mailman/listinfo/python-list
Re: Absolute beginner
In Python 3 the syntax for print has changed to print() so just put braces around the string and you'r good to go! On Wed, Dec 30, 2009 at 12:48 PM, wrote: > Hi there, > I installed python 3.1 on Windows Vista PC. > Am an absolute beginner with Python. > This is my problem : > > In Idle : > > Python 3.1.1 (r311:74483, Aug 17 2009, 17:02:12) [MSC v.1500 32 bit > (Intel)] on win32 > Type "copyright", "credits" or "license()" for more information. print "Hello" > SyntaxError: invalid syntax (, line 1) > > At a dos-prompt : > > Python 3.1.1 (r311:74483, Aug 17 2009, 17:02:12) [MSC v.1500 32 bit > (Intel)] on > win32 > Type "help", "copyright", "credits" or "license" for more information. print "Hello" > File "", line 1 > print "Hello" > ^ > SyntaxError: invalid syntax > > Looks stupid, probably is, but I cannot figure it out. > > Thanks for any help ! > > Lucky > > -- > http://mail.python.org/mailman/listinfo/python-list > -- http://mail.python.org/mailman/listinfo/python-list
Re: list comprehension problem
On Mon, Nov 2, 2009 at 10:11 PM, Aahz wrote: > In article > <7589e0a1-98b2-4df4-bc76-5d4c10194...@f20g2000prn.googlegroups.com>, > Falcolas wrote: >> >>I'd also recommend trying the following filter, since it is identical >>to what you're trying to do, and will probably catch some additional >>edge cases without any additional effort from you. >> >>[s.strip() for s in hosts if s.strip()] > > This breaks if s might be None If you don't want Nones in your list just make a check for it... [s.strip() for s in hosts if s is not None and s.strip()] -- http://mail.python.org/mailman/listinfo/python-list
