Re: [R] Error in DGEList function

On 10/15/2010 06:17 AM, Ying Ye wrote: Hi! I am a new R user and have no clue of this error (see below) while using edgeR package: edgeR is a Bioconductor pacakge so please subscribe to the Bioconductor list and ask there. http://bioconductor.org/help/mailing-list/ include the output of

Re: [R] overloading the generic primitive functions + and [

On 10/28/2010 02:17 AM, Barry Rowlingson wrote: On Thu, Oct 28, 2010 at 9:31 AM, Mark Heckmann mark.heckm...@gmx.de wrote: How can I add a new method to the generic function [ or + I want to create a S3 and S4 class that will use the [ and + method in a different way. How can I overload

Re: [R] how to work with long vectors

On 11/04/2010 09:45 AM, Changbin Du wrote: Thanks, Jim! This is not what I want, What I want is calculate the percentage of reads bigger or equal to that reads in each position.MY output is like the following: Hi Changbin -- I might be repeating myself, but the Bioconductor packages

Re: [R] how to work with long vectors

On 11/05/2010 09:13 AM, Changbin Du wrote: HI, Phil, I used the following codes and run it overnight for 15 hours, this morning, I stopped it. It seems it is still not efficient.

Re: [R] how to work with long vectors

On 11/05/2010 09:42 AM, Martin Morgan wrote: ## first time only source(http://bioconductor.org;) oops, source(http://bioconductor.org/biocLite.R;) biocLite(IRanges) ## library(IRanges) contigs = IRanges(start=1, width=matt$reads) cvg = coverage(contigs) ## an RLE summarizing coverage

Re: [R] Problem on running update

On 11/20/2010 08:56 PM, Stephen Liu wrote: Hi folks, Win 7 64bit R 2.12.) Today on running: update.packages() Error: subscript out of bounds Unable to proceed. I have been googling around and couldn't discover the cause. Pls help. TIA Hi Stephen -- maybe

Re: [R] Problem on running update

- Original Message From: Martin Morgan mtmor...@fhcrc.org To: Stephen Liu sati...@yahoo.com Cc: r-help@r-project.org Sent: Sun, November 21, 2010 2:10:52 PM Subject: Re: [R] Problem on running update On 11/20/2010 08:56 PM, Stephen Liu wrote: Hi folks, Win 7 64bit R 2.12.) Today

Re: [R] Problem on running update

methods base loaded via a namespace (and not attached): [1] tools_2.12.0 Martin starting httpd help server ... done Browser[1] ?recover Looked at them and wondered what to do next? B.R. Stephen L - Original Message From: Martin Morgan mtmor...@fhcrc.org

Re: [R] ACCTGMX to 1223400 in R?

] 7 1224300 as.character(chartr(...)) would get a character vector(s) back. Martin Please advise. Thank you. -- -- Martin Morgan Computational Biology / Fred Hutchinson Cancer Research Center 1100 Fairview Ave. N. PO Box 19024 Seattle, WA 98109 Location: Arnold Building M1 B861 Phone

Re: [R] String processing - is there a better way

the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. -- Martin Morgan Computational Biology / Fred Hutchinson Cancer Research Center 1100 Fairview Ave. N. PO Box 19024 Seattle, WA 98109 Location: Arnold Building M1 B861 Phone

Re: [R] assignment functions with inherited class error

. -- Martin Morgan Computational Biology / Fred Hutchinson Cancer Research Center 1100 Fairview Ave. N. PO Box 19024 Seattle, WA 98109 Location: Arnold Building M1 B861 Phone: (206) 667-2793 __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman

Re: [R] vector allocation error

. Martin -- Martin Morgan Computational Biology / Fred Hutchinson Cancer Research Center 1100 Fairview Ave. N. PO Box 19024 Seattle, WA 98109 Location: Arnold Building M1 B861 Phone: (206) 667-2793 __ R-help@r-project.org mailing list https://stat.ethz.ch

Re: [R] Comparing/diffing strings

] 1 string mismatch Does any one know of any good text diffing tools implemented in R? Thanks, Hadley -- Martin Morgan Computational Biology / Fred Hutchinson Cancer Research Center 1100 Fairview Ave. N. PO Box 19024 Seattle, WA 98109 Location: Arnold Building M1 B861 Phone: (206) 667

Re: [R] Passing arguments between S4 methods fails within a function:bug? example with raster package.

On 8/26/2010 8:43 AM, Niels Richard Hansen wrote: setGeneric(myplus,function(x,y,...) standardGeneric(myplus)) setMethod(myplus,c(x=numeric,y=numeric), function(x,y,z=0) x+y+z ) setMethod(myplus,c(x=numeric,y=list), function(x,y,...) callGeneric(x,unlist(y),...)

Re: [R] Error: package/namespace load failed for 'IlluminaHumanMethylation27k.db'

and provide commented, minimal, self-contained, reproducible code. -- Martin Morgan Computational Biology / Fred Hutchinson Cancer Research Center 1100 Fairview Ave. N. PO Box 19024 Seattle, WA 98109 Location: Arnold Building M1 B861 Phone: (206) 667-2793

Re: [R] non-zero exit status error when install GenomeGraphs

On 09/04/2010 01:38 PM, David Winsemius wrote: (Caveat: I am not a bioc user.) The error messages suggest that you are missing dependencies. I looked at the documentation for GenomeGraphs and it does not list any dependencies, but I have no way of knowing how careful

Re: [R] Multiple CPU HowTo in Linux?

On 09/14/2010 08:36 AM, Christian Raschke wrote: Edwin, I'm not sure what you mean by adapting; other than installing multicore, there is nothing else to set up. How and whether you could then parallelise your code strongly depends on the specific problem you are facing. What have done

Re: [R] Error: cannot allocate vector of size X.0 Mb

On 09/14/2010 08:02 AM, Marc Schwartz wrote: On Sep 14, 2010, at 9:47 AM, John1983 wrote: Yes I see. So I typed as you mentioned and I get an 8 (therefore this is a 64-bit R). Is there anything else I need to check to remove this error? 1. Add more RAM. 2. Depending upon what you

Re: [R] test to see if a s4 property is assigned?

On 09/15/2010 12:03 PM, darckeen wrote: Class(person,representation(age=numeric,weight=numeric)) [1] person bob - new(person,age=30) is.null(b...@weight) [1] FALSE b...@weight numeric(0) b...@weight == numeric(0) logical(0) Hi darckeen -- use the prototype argument to setClass to

Re: [R] test to see if a s4 property is assigned?

On 09/16/2010 02:23 PM, darckeen wrote: setClass(person,representation(age=numeric,weight=numeric),prototype(age=NULL,weight=NULL)) [1] person bob - new(person,age=30) Error in validObject(.Object) : invalid class person object: invalid object for slot weight in class person: got class

Re: [R] Loop too slow for Bid calc - BUT cannot figure out how to do with matrix

On 10/04/2010 02:29 PM, rivercode wrote: Hi, I am trying to create Bid/Ask for each second from a high volume stock and the only way I have been able to solve this is using loops to create the target matrix from the source tick data matrix. Looping is too slow and not practical to use

Re: [R] Matching long strings ... was Re: Memory management in R

On 10/10/2010 07:11 AM, David Winsemius wrote: On Oct 10, 2010, at 9:27 AM, Lorenzo Isella wrote: I already offered the Biostrings package. It provides more robust methods for string matching than does grepl. Is there a reason that you choose not to? Indeed that is the way I should go

Re: [R] Matching long strings ... was Re: Memory management in R

On 10/10/2010 11:00 AM, David Winsemius wrote: On Oct 10, 2010, at 11:35 AM, Martin Morgan wrote: On 10/10/2010 07:11 AM, David Winsemius wrote: On Oct 10, 2010, at 9:27 AM, Lorenzo Isella wrote: I already offered the Biostrings package. It provides more robust methods for string

Re: [R] A programming question - is what I want to do possible in R?

-guide.html and provide commented, minimal, self-contained, reproducible code. -- Martin Morgan Computational Biology / Fred Hutchinson Cancer Research Center 1100 Fairview Ave. N. PO Box 19024 Seattle, WA 98109 Location: Arnold Building M1 B861 Phone: (206) 667-2793

Re: [R] How to compile R with command completion?

-guide.html and provide commented, minimal, self-contained, reproducible code. -- Martin Morgan Computational Biology / Fred Hutchinson Cancer Research Center 1100 Fairview Ave. N. PO Box 19024 Seattle, WA 98109 Location: Arnold Building M1 B861 Phone: (206) 667-2793

Re: [R] How to compile R with command completion?

Peng Yu wrote: On Tue, Sep 29, 2009 at 10:39 PM, Martin Morgan mtmor...@fhcrc.org wrote: Peng Yu wrote: On Tue, Sep 29, 2009 at 3:47 PM, Tobias Verbeke tobias.verb...@gmail.com wrote: Peng Yu wrote: I want to compile R with command completion. But I don't find such an option in configure

Re: [R] question

, minimal, self-contained, reproducible code. -- Martin Morgan Computational Biology / Fred Hutchinson Cancer Research Center 1100 Fairview Ave. N. PO Box 19024 Seattle, WA 98109 Location: Arnold Building M1 B861 Phone: (206) 667-2793 __ R-help@r

Re: [R] R and computer size

]] __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. -- Martin Morgan Computational

Re: [R] How to get the definition of a class?

guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. -- Martin Morgan Computational Biology / Fred Hutchinson Cancer Research Center 1100 Fairview Ave. N. PO Box 19024 Seattle, WA 98109 Location: Arnold Building M1 B861 Phone: (206

Re: [R] How to get the definition of a class?

Peng Yu wrote: On Tue, Oct 13, 2009 at 9:38 PM, Martin Morgan mtmor...@fhcrc.org wrote: Peng Yu wrote: Hi, ExonFeatureSet I have an object of the above class. The following document mentioned it. http://www.bioconductor.org/packages/2.5/bioc/vignettes/oligo/inst/doc/ClassesUsedInOligo.pdf

Re: [R] Cacheing computationally expensive getter methods for S4 objects

/contact __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. -- Martin Morgan

Re: [R] Defining S3-methods for S4-objects: cannot coerce type 'S4' to vector of type 'integer'

-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. -- Martin Morgan Computational Biology / Fred Hutchinson Cancer Research Center 1100

Re: [R] warnings details

warning: simpleWarning in log(-1:1): NaNs produced my warning: simpleWarning in sqrt(y): NaNs produced x [1] NaN NaN 0 Martin -- Martin Morgan Computational Biology / Fred Hutchinson Cancer Research Center 1100 Fairview Ave. N. PO Box 19024 Seattle, WA 98109 Location: Arnold Building M1 B861

Re: [R] What is the most efficient practice to develop an R package?

-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. -- Martin Morgan Computational Biology / Fred Hutchinson Cancer Research Center 1100 Fairview Ave. N. PO Box 19024 Seattle, WA 98109 Location: Arnold Building M1 B861 Phone: (206) 667-2793

Re: [R] Why 'validity' is not called? (S4)

guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. -- Martin Morgan Computational Biology / Fred Hutchinson Cancer Research Center 1100 Fairview Ave. N. PO Box 19024 Seattle, WA 98109 Location: Arnold Building M1 B861 Phone: (206

Re: [R] R.oo and S4?

-contained, reproducible code. -- Martin Morgan Computational Biology / Fred Hutchinson Cancer Research Center 1100 Fairview Ave. N. PO Box 19024 Seattle, WA 98109 Location: Arnold Building M1 B861 Phone: (206) 667-2793 __ R-help@r-project.org mailing

Re: [R] How to browse all the functions in a package?

guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. -- Martin Morgan Computational Biology / Fred Hutchinson Cancer Research Center 1100 Fairview Ave. N. PO Box 19024 Seattle, WA 98109 Location: Arnold Building M1 B861 Phone: (206

Re: [R] What is the most efficient practice to develop an R package?

Dirk Eddelbuettel wrote: On 26 October 2009 at 13:29, Peng Yu wrote: | On Mon, Oct 26, 2009 at 11:22 AM, Dirk Eddelbuettel e...@debian.org wrote: | | On 26 October 2009 at 07:57, Martin Morgan wrote: | | Peng Yu wrote: | | I am reading Section 5 and 6 of | | http://cran.r-project.org

Re: [R] Why 'validity' is not called? (S4)

Peng Yu wrote: On Mon, Oct 26, 2009 at 1:49 PM, Martin Morgan mtmor...@fhcrc.org wrote: Peng Yu wrote: I thought that 'validity' defined in 'setClass' should be called in 'new'. Could somebody let me know why 'validity' is not called? How to make it be called? setClass( + Class

Re: [R] How to union the elements in a list?

to compute the union of all the vectors in the list. I could use 'for' loop to do so. But I'm wondering what would be a better solution that does not need a 'for' loop. l=list(a=c(1,3,4), b=c(1,3,6), c=c(1,3,7), ) Reduce(union,l) -- Martin Morgan Computational Biology / Fred Hutchinson

Re: [R] avoiding loop

-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. -- Martin Morgan Computational Biology / Fred Hutchinson Cancer Research Center 1100 Fairview Ave. N. PO Box 19024 Seattle, WA 98109 Location

Re: [R] standardGeneric seems slow; any way to get around it?

and provide commented, minimal, self-contained, reproducible code. -- Martin Morgan Computational Biology / Fred Hutchinson Cancer Research Center 1100 Fairview Ave. N. PO Box 19024 Seattle, WA 98109 Location: Arnold Building M1 B861 Phone: (206) 667-2793

Re: [R] problems in installing biomart

]] __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. -- Martin Morgan Computational Biology / Fred Hutchinson Cancer

Re: [R] sequence clustering and assembly

]] __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. -- Martin Morgan Computational Biology / Fred

Re: [R] hugene10stv1cdf

Christoph __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. -- Martin

Re: [R] memory limit

://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. -- Martin Morgan Computational Biology / Fred Hutchinson Cancer Research Center 1100 Fairview Ave. N. PO Box 19024

Re: [R] rtracker dependencies installation problem?

commented, minimal, self-contained, reproducible code. -- Martin Morgan Computational Biology / Fred Hutchinson Cancer Research Center 1100 Fairview Ave. N. PO Box 19024 Seattle, WA 98109 Location: Arnold Building M1 B861 Phone: (206) 667-2793 __ R

Re: [R] slot assignment in S4 classes

commented, minimal, self-contained, reproducible code. -- Martin Morgan Computational Biology / Fred Hutchinson Cancer Research Center 1100 Fairview Ave. N. PO Box 19024 Seattle, WA 98109 Location: Arnold Building M1 B861 Phone: (206) 667-2793 __ R-help

Re: [R] a question about beadarray in R

-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. -- Martin Morgan Computational Biology / Fred Hutchinson Cancer Research Center 1100 Fairview Ave. N. PO Box 19024 Seattle, WA 98109 Location: Arnold Building M1 B861 Phone: (206) 667-2793

Re: [R] computer out of memory when using sigpathway

do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. Rr -- Martin Morgan Computational Biology / Fred Hutchinson Cancer Research Center 1100 Fairview Ave. N. PO Box 19024 Seattle, WA 98109 Location: Arnold

Re: [R] getSubClasses()?

]] __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. -- Martin Morgan Computational Biology / Fred

Re: [R] Error during wrapup: cannot open the connection

, self-contained, reproducible code. -- Martin Morgan Computational Biology / Fred Hutchinson Cancer Research Center 1100 Fairview Ave. N. PO Box 19024 Seattle, WA 98109 Location: Arnold Building M1 B861 Phone: (206) 667-2793 __ R-help@r-project.org

Re: [R] analyse tab delimited textfile microarray data(help)

PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. -- Martin Morgan Computational Biology / Fred Hutchinson Cancer Research Center 1100 Fairview Ave. N. PO Box 19024 Seattle, WA 98109 Location: Arnold

Re: [R] S4 Classes, nested objects and references

mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. -- Martin Morgan Computational Biology / Fred Hutchinson Cancer Research Center 1100

Re: [R] read.affy.mixed - subscript out of bounds error

__ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. -- Martin Morgan Computational Biology / Fred

Re: [R] memory problem on Suse

Ask on the bioconductpr mailing list, where you will be diirected to several solutions for analyzing what I guess are 100's is cel files http://bioconductor.org -- Martin Morgan On Dec 11, 2009, at 8:02 AM, Marc Schwartz marc_schwa...@me.com wrote: On Dec 11, 2009, at 6:24 AM, Ambrosi

Re: [R] Fwd: Error with hgu133a2.db

__ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. -- Martin Morgan

Re: [R] Rgraphviz installation

the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. -- Martin Morgan Computational Biology / Fred Hutchinson Cancer Research Center 1100 Fairview Ave. N. PO Box 19024 Seattle, WA 98109 Location: Arnold Building M1 B861 Phone

Re: [R] Rgraphviz on mac 10.6.2

mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. -- Martin Morgan Computational Biology / Fred Hutchinson Cancer Research Center 1100

Re: [R] Question to use R plot GO pie chart

and provide commented, minimal, self-contained, reproducible code. -- Martin Morgan Computational Biology / Fred Hutchinson Cancer Research Center 1100 Fairview Ave. N. PO Box 19024 Seattle, WA 98109 Location: Arnold Building M1 B861 Phone: (206) 667-2793

Re: [R] [BioC] make.cdf.package: Error: cannot allocate vector of size 1 Kb

and provide commented, minimal, self-contained, reproducible code. -- Martin Morgan Computational Biology / Fred Hutchinson Cancer Research Center 1100 Fairview Ave. N. PO Box 19024 Seattle, WA 98109 Location: Arnold Building M1 B861 Phone: (206) 667-2793 __ R

Re: [R] Problem with S4 generic function print

__ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. -- Martin Morgan Computational Biology / Fred

Re: [R] Methods to explore R data structures

/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. -- Martin Morgan Computational Biology / Fred Hutchinson Cancer Research Center 1100 Fairview Ave. N. PO Box 19024 Seattle, WA

Re: [R] Faster union of polygons?

-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. -- Martin Morgan Computational Biology / Fred Hutchinson Cancer Research Center

Re: [R] how to group a large list of strings into categories based on string similarity?

/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. -- Martin Morgan Computational Biology / Fred Hutchinson Cancer Research Center 1100 Fairview Ave. N. PO Box 19024 Seattle, WA 98109

Re: [R] how to group a large list of strings into categories based on string similarity?

On 06/23/2010 07:46 PM, Martin Morgan wrote: On 06/23/2010 06:55 PM, G FANG wrote: Hi, I want to group a large list (20 million) of strings into categories based on string similarity? The specific problem is: given a list of DNA sequence as below ACTCCCGCCGTTCGCGCGCAGCATGATCCTG

Re: [R] how to group a large list of strings into categories based on string similarity?

://bioconductor.org/docs/mailList.html Martin Thanks! --gang On Wed, Jun 23, 2010 at 7:55 PM, Martin Morgan mtmor...@fhcrc.org wrote: On 06/23/2010 07:46 PM, Martin Morgan wrote: On 06/23/2010 06:55 PM, G FANG wrote: Hi, I want to group a large list (20 million) of strings

Re: [R] S4 classes and debugging - Is there a summary?

for Data Analysis... and Gentleman's 2008 R Programming for Bioinformatics... books would be where I'd start. ?Methods and ?Classes are I think under-used. Martin Cheers Joris -- Martin Morgan Computational Biology / Fred Hutchinson Cancer Research Center 1100 Fairview Ave. N. PO Box

Re: [R] RCurl question

code. -- Martin Morgan Computational Biology / Fred Hutchinson Cancer Research Center 1100 Fairview Ave. N. PO Box 19024 Seattle, WA 98109 Location: Arnold Building M1 B861 Phone: (206) 667-2793 __ R-help@r-project.org mailing list https://stat.ethz.ch

Re: [R] Help reg Genome view

commented, minimal, self-contained, reproducible code. -- Martin Morgan Computational Biology / Fred Hutchinson Cancer Research Center 1100 Fairview Ave. N. PO Box 19024 Seattle, WA 98109 Location: Arnold Building M1 B861 Phone: (206) 667-2793 __ R-help@r

Re: [R] Could not find createData function

]] __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. -- Martin Morgan Computational Biology / Fred Hutchinson Cancer

Re: [R] trouble with installing SJava

-lR /usr/bin/ld: cannot find -lRSNativeJava collect2: ld returned 1 exit status make: *** [SJava.so] Error 1 ERROR: compilation failed for package ‘SJava’ * removing ‘/usr/local/lib/R/site-library/SJava’ -- Martin Morgan Computational Biology / Fred Hutchinson Cancer Research Center 1100

Re: [R] Cannot load RInterpreter (SJava)

/libs as a VM argument. Martin Who can help me? Thanks -- Martin Morgan Computational Biology / Fred Hutchinson Cancer Research Center 1100 Fairview Ave. N. PO Box 19024 Seattle, WA 98109 Location: Arnold Building M1 B861 Phone: (206) 667-2793

Re: [R] Reg: Rgraphviz installation

. -- Martin Morgan Computational Biology / Fred Hutchinson Cancer Research Center 1100 Fairview Ave. N. PO Box 19024 Seattle, WA 98109 Location: Arnold Building M1 B861 Phone: (206) 667-2793 __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman

Re: [R] Posting an 'S4-creating Package Problem'...

/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. -- Martin Morgan Computational Biology / Fred Hutchinson Cancer Research Center 1100 Fairview Ave. N. PO Box 19024 Seattle, WA 98109

Re: [R] using setMethod or setGeneric to change S4 accessor symbol from @ to $

-contained, reproducible code. -- Martin Morgan Computational Biology / Fred Hutchinson Cancer Research Center 1100 Fairview Ave. N. PO Box 19024 Seattle, WA 98109 Location: Arnold Building M1 B861 Phone: (206) 667-2793 __ R-help@r-project.org mailing

Re: [R] Error on start R in server

: readline: readline_callback_read_char() called with no handler! 1 bash: 1: command not found -- Martin Morgan Computational Biology / Fred Hutchinson Cancer Research Center 1100 Fairview Ave. N. PO Box 19024 Seattle, WA 98109 Location: Arnold Building M1 B861 Phone: (206) 667-2793

Re: [R] using setMethod or setGeneric to change S4 accessor symbol from @ to $

as they would for data frames? Thanks so much for your help. same approach, but using getGeneric([) and getGeneric([-) to guide you. Martin Best, Markus On Mon, Feb 8, 2010 at 2:44 PM, Martin Morgan mtmor...@fhcrc.org wrote: On 02/07/2010 08:31 PM, Markus Weisner wrote: I created

Re: [R] using setMethod or setGeneric to change S4 accessor symbol from @ to $

object slots using @ and a character variable. I also cannot access a slot using the typical brackets since that is what I am trying to define here. Kind of stuck. Thanks for any advice you might have. Best, Markus On Mon, Feb 8, 2010 at 4:54 PM, Martin Morgan mtmor...@fhcrc.org wrote

Re: [R] Error on start R in server

(with the --no-save) means that any .RData or other R startup file, including those in the web application 'home' directory, will be loaded when R starts. I hope this provides some help; if it works out of the web app, but not in it, then it is a web app configuration issue. Martin -- Martin Morgan

Re: [R] Using R to format a file using a server (PDB to PQR file)

) into the upload pdb file input, and run the website and give the return file to be a pqr file. Thanks for your help. Maybe bio3d::write.pqr is for you? http://mccammon.ucsd.edu/~bgrant/bio3d/index.html Martin -- Martin Morgan Computational Biology / Fred Hutchinson Cancer Research Center

Re: [R] Using getSYMBOL, annotate package on a list with empty elements.

, self-contained, reproducible code. -- Martin Morgan Computational Biology / Fred Hutchinson Cancer Research Center 1100 Fairview Ave. N. PO Box 19024 Seattle, WA 98109 Location: Arnold Building M1 B861 Phone: (206) 667-2793 __ R-help@r-project.org

Re: [R] Using getSYMBOL, annotate package on a list with empty elements.

On 02/13/2010 07:17 AM, David Winsemius wrote: On Feb 13, 2010, at 10:09 AM, Martin Morgan wrote: On 02/13/2010 06:21 AM, David Winsemius wrote: On Feb 13, 2010, at 3:18 AM, Sahil Seth wrote: Hi, I have been trying to find a solution to this issue, but have not been able to so ! I am

Re: [R] How to create probeAnno object?

and provide commented, minimal, self-contained, reproducible code. -- Martin Morgan Computational Biology / Fred Hutchinson Cancer Research Center 1100 Fairview Ave. N. PO Box 19024 Seattle, WA 98109 Location: Arnold Building M1 B861 Phone: (206) 667-2793

Re: [R] Extract information from S4 object

-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. -- Martin Morgan Computational Biology / Fred Hutchinson Cancer Research Center

Re: [R] importing S4 methods using a namespace

how they do. Martin Thanks, -- Martin Morgan Computational Biology / Fred Hutchinson Cancer Research Center 1100 Fairview Ave. N. PO Box 19024 Seattle, WA 98109 Location: Arnold Building M1 B861 Phone: (206) 667-2793 __ R-help@r-project.org

Re: [R] Error: cannot allocate vector of size...

list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. -- Martin Morgan Bioconductor / Computational Biology http://bioconductor.org

Re: [R] Qsub - unable to open connection to X11 display

https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. -- Martin Morgan Computational Biology Shared Resource Director Fred Hutchinson Cancer Research Center

Re: [R] Print list structure

Hi Antje, I know you have a solution, but l - list(list(L=1,list(L=2))) f - function() { i=1; function(...) {cat(level, i, :, ...); i-i+1 }} r=rapply(l, f(), ...=\n) level 1 : 1 level 2 : 2 lets you use R scoping rules and a relatively new addition to the 'apply' family of functions. It

Re: [R] learning S4

__ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. -- Martin Morgan Computational Biology / Fred Hutchinson

Re: [R] counting sequence mismatches

One kind of ugly solution d.f=data.frame(seq1, seq2, stringsAsFactors=FALSE) d.f[[nMismatch]] - with(d.f, { + m - mapply(!=, strsplit(seq1, ), strsplit(seq2, )) + colSums(m) + }) Check out the Bioconductor Biostrings package, especially the version available with the development version

Re: [R] Set without argument

and provide commented, minimal, self-contained, reproducible code. -- Martin Morgan Computational Biology / Fred Hutchinson Cancer Research Center 1100 Fairview Ave. N. PO Box 19024 Seattle, WA 98109 Location: Arnold Building M2 B169 Phone: (206) 667-2793

Re: [R] Standard method for S4 object

Christophe Genolini wrote: /I think your question should be more relevant on Rdev./ ok, I will Personnally I would find stuff like names, $, $-, or [ useful as these are usual operation with S3 objects. Is it possible in S4 to define $- ? If there is a slot name 'a' in Possible yes, see

Re: [R] Generic Functions

See the 'useAsDefault' argument to setGeneric. As an aside, if 'setType-' is meant to be a 'setter' to change the value of a slot 'type', then I find the syntax a little redundant -- it's use setType(x) - foo implies that it is already a 'setter' without 'set' at the front. Why not just

Re: [R] problem with creation of eSet

PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. -- Martin Morgan Computational Biology / Fred Hutchinson Cancer Research Center 1100 Fairview Ave. N. PO Box 19024 Seattle, WA 98109 Location: Arnold

Re: [R] inheritence in S4

and provide commented, minimal, self-contained, reproducible code. -- Martin Morgan Computational Biology / Fred Hutchinson Cancer Research Center 1100 Fairview Ave. N. PO Box 19024 Seattle, WA 98109 Location: Arnold Building M2 B169 Phone: (206) 667-2793

Re: [R] inheritence in S4

-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. -- Martin Morgan Computational Biology / Fred Hutchinson Cancer

Re: [R] inheritence in S4

, reproducible code. -- Martin Morgan Computational Biology / Fred Hutchinson Cancer Research Center 1100 Fairview Ave. N. PO Box 19024 Seattle, WA 98109 Location: Arnold Building M2 B169 Phone: (206) 667-2793 Ce message a ete

Re: [R] inheritence in S4

and provide commented, minimal, self-contained, reproducible code. -- Martin Morgan Computational Biology / Fred Hutchinson Cancer Research Center 1100 Fairview Ave. N. PO Box 19024 Seattle, WA 98109 Location: Arnold Building M2 B169 Phone: (206) 667-2793

Re: [R] expression matrix

https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. -- Martin Morgan Computational Biology / Fred Hutchinson Cancer Research Center 1100 Fairview Ave. N. PO Box

  1   2   3   4   5   6   >