[freenet-support] Negative Local Ports
-BEGIN PGP SIGNED MESSAGE- Hash: SHA1 For sometime now (3 or 4 weeks I think) I have been noticing -ve Local Port numbers being reported in the Open Connection Manager screen (Connection Mode). It does not seem to be associated with the remote node build since atm I have 3 connections to a node, 2 with -ve numbers and 1 with a +ve number. I might add that I have 67 other connections to other nodes before you have a heart attack. All other Local Ports are in the range of 3000 to 5000. The negative Local Port number is -5 for both. Just rechecked and all 3 connections to the node are now -5. C:\USR\LOCAL\Freenet0.5 [\\VIXEN\Richard]$ ver Microsoft Windows XP [Version 5.1.2600] C:\USR\LOCAL\Freenet0.5 [\\VIXEN\Richard]$ java freenet.Version Freenet: Fred 0.6 (protocol 1.47) build 6339 (last good build: 6280) C:\USR\LOCAL\Freenet0.5 [\\VIXEN\Richard]$ java -version java version 1.4.2_01 Java(TM) 2 Runtime Environment, Standard Edition (build 1.4.2_01-b06) Java HotSpot(TM) Client VM (build 1.4.2_01-b06, mixed mode) Will install 6340 and check with that. Probably take some time to spot it though as it doesn't happen very often. Richard - -- - CATGACGCACTAGCGGATTCCAATCGGGTAGTTCCGCGCACTTATGCCTCAATAGATCTGCCACATCG CATGGTGATCATCCCATTCTTCGCCCGGGATATCTTAAGCAATGAAGTGTGGCATCCGCTTCAG dna.pl v0.2.4 (c) 20020613 (tm) rich at mibnet.plus.com -BEGIN PGP SIGNATURE- Version: GnuPG v1.2.3-nr1 (Windows XP) Comment: Using GnuPG with Thunderbird - http://enigmail.mozdev.org iD8DBQE/uzFyDehCPPrjI9gRAhVdAJ4vKRMTQxApFfHGEnB38web3aOAgQCfb5N+ 9PrmpUDUqEeAPgXapjUw6Pk= =Qpl2 -END PGP SIGNATURE- -- This message has been swept clean of viruses by AVG Anti Virus email Scanner. http://www.grisoft.com/html/us_index.cfm Checked by AVG anti-virus system (http://www.grisoft.com). Version: 6.0.541 / Virus Database: 335 - Release Date: 15/11/2003 ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
RE: [freenet-support] Negative Local Ports
Btw. This should now be 'fixed' in latest cvs. Textual descriptions will be displayed instead of those negative numbers. /N -Original Message- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED] On Behalf Of Niklas Bergh Sent: den 19 november 2003 10:07 To: [EMAIL PROTECTED]; [EMAIL PROTECTED] Subject: RE: [freenet-support] Negative Local Ports These are a programmatical thingy.. They tend to mean that something is wrong with the connection in question.. Maybe not fully opened yet.. Maybe on its way to closing. Check the mailing list archives for an exact description. /N -BEGIN PGP SIGNED MESSAGE- Hash: SHA1 For sometime now (3 or 4 weeks I think) I have been noticing -ve Local Port numbers being reported in the Open Connection Manager screen (Connection Mode). It does not seem to be associated with the remote node build since atm I have 3 connections to a node, 2 with -ve numbers and 1 with a +ve number. I might add that I have 67 other connections to other nodes before you have a heart attack. All other Local Ports are in the range of 3000 to 5000. The negative Local Port number is -5 for both. Just rechecked and all 3 connections to the node are now -5. C:\USR\LOCAL\Freenet0.5 [\\VIXEN\Richard]$ ver Microsoft Windows XP [Version 5.1.2600] C:\USR\LOCAL\Freenet0.5 [\\VIXEN\Richard]$ java freenet.Version Freenet: Fred 0.6 (protocol 1.47) build 6339 (last good build: 6280) C:\USR\LOCAL\Freenet0.5 [\\VIXEN\Richard]$ java -version java version 1.4.2_01 Java(TM) 2 Runtime Environment, Standard Edition (build 1.4.2_01-b06) Java HotSpot(TM) Client VM (build 1.4.2_01-b06, mixed mode) Will install 6340 and check with that. Probably take some time to spot it though as it doesn't happen very often. Richard - -- - -- -- CATGACGCACTAGCGGATTCCAATCGGGTAGTTCCGCGCACTTATGCCTCAATAGATC TGCCACATCG CATGGTGATCATCCCATTCTTCGCCCGGGATATCTTAAGCAATGAAGTGTGGCATCCT TTTGCTTCAG dna.pl v0.2.4 (c) 20020613 (tm) rich at mibnet.plus.com -BEGIN PGP SIGNATURE- Version: GnuPG v1.2.3-nr1 (Windows XP) Comment: Using GnuPG with Thunderbird - http://enigmail.mozdev.org iD8DBQE/uzFyDehCPPrjI9gRAhVdAJ4vKRMTQxApFfHGEnB38web3aOAgQCfb5N+ 9PrmpUDUqEeAPgXapjUw6Pk= =Qpl2 -END PGP SIGNATURE- -- ** ** This message has been swept clean of viruses by AVG Anti Virus email Scanner. http://www.grisoft.com/html/us_index.cfm ** ** Checked by AVG anti-virus system (http://www.grisoft.com). Version: 6.0.541 / Virus Database: 335 - Release Date: 15/11/2003 ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/suppor t ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Re: [freenet-support] minor bug webinstaller
At 18-11-2003, out of the blue, an email from Dave Hooper entitled 'Re: [freenet-support] minor bug webinstaller' surprised me with: Could you tell me under what circumstances the webinstaller will try to overwrite itself while running please? I see this only happening if you first download the webinstaller into the freenet application folder, and then run it, which is not really intended. If that is what you do (and if it is indeed common) then maybe I'll code for that behaviour. This intention is kinda that you just run (rather than download-and-save) the webinstaller! I don't understand what you mean, like, the installer is started remotely? It happens when I've got the webinstaller in its default place (I guess), in the Freenet dir, and run 'Update Snapshot' from the startmenu. I don't have my Freenet installation on C:, but on the second of quite a few partitions. If I copy the installer into a subdir and run it by starting the .exe, there is no trouble. BTW: the installer offers me as the only option to install 'Freenet Node', Space required 2.0 KB it sais, and then apparently gets the entire installation. Also not what you intend to show I reckon. For one like me with cable it's no problem to download a couple of megabytes but those with slower pipes won't be happy. -- groet! jan . ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Re: [freenet-support] minor bug webinstaller
It happens when I've got the webinstaller in its default place (I guess), in the Freenet dir, and run 'Update Snapshot' from the startmenu. Hm, right. That really really shouldn't happen! It's designed to not try and copy over itself if run from its default location for obvious reasons! I'll take a look at this when I have a chance. I don't have my Freenet installation on C:, but on the second of quite a few partitions. Yeh, that's fine. My installation isn't on C: either (in fact I don't use C for anything whatsoever) If I copy the installer into a subdir and run it by starting the .exe, there is no trouble. BTW: the installer offers me as the only option to install 'Freenet Node', Space required 2.0 KB it sais, and then apparently gets the entire installation. Also not what you intend to show I reckon. For one like me with cable it's no problem to download a couple of megabytes but those with slower pipes won't be happy. Yeh, it reports space required as that's approximately how much space it needs in addition to what's already on your system. Additional Space if you like. But because it's a webinstall it automatically tries to download the latest components, freenet.exe, NodeConfig.exe, etc. There's no option to only download the latest .jar but not any of the other components I'm afraid but this should probably be added. The webinstaller needs a huge overhaul at this time, but I don't have the time to do this for the forseeable future. d ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Re: [freenet-support] Freenet stable 5030 - major bug fix
the rabbit icon I like to see it as a dolphin, am I a weirdo now? Maybe! ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Re: [freenet-support] Freenet Stable Build 5039
This build turns off rejecting queries based on output bandwidth usage, a feature that is unnecessary (we have other ways of limiting bandwidth usage) and counterproductive to routing. Maybe so, but I doubt having a Data waiting to be transmitted value above 30 minutes worth of transmission (with full bandwidth usage) is good for the routing, either. I noticed the value notably lower in the latest builds (in the order of 5-10 minutes) with the bandwidth usage-based queryreject; I hope things won't get Mighty Bad again :) Might a I have the key you need but my band is full and can't send it right now, try searching with the other nodes meanwhile and come back later if you really need it message help such situation? -- /~\ The ASCIITLD \ / Ribbon Campaign They that can give up essential liberty to obtain X Against HTMLa little temporary safety deserve neither liberty / \ Email! nor safety. -- Benjamin Franklin ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Re: [freenet-support] Freenet Stable Build 5039
Or.. as NGR would do it.. Hmmm.. that node is one slow sucker.. better send the query to another one next time. /N - Original Message - From: TLD [EMAIL PROTECTED] To: [EMAIL PROTECTED] Sent: Wednesday, November 19, 2003 6:07 PM Subject: Re: [freenet-support] Freenet Stable Build 5039 This build turns off rejecting queries based on output bandwidth usage, a feature that is unnecessary (we have other ways of limiting bandwidth usage) and counterproductive to routing. Maybe so, but I doubt having a Data waiting to be transmitted value above 30 minutes worth of transmission (with full bandwidth usage) is good for the routing, either. I noticed the value notably lower in the latest builds (in the order of 5-10 minutes) with the bandwidth usage-based queryreject; I hope things won't get Mighty Bad again :) Might a I have the key you need but my band is full and can't send it right now, try searching with the other nodes meanwhile and come back later if you really need it message help such situation? -- /~\ The ASCIITLD \ / Ribbon Campaign They that can give up essential liberty to obtain X Against HTMLa little temporary safety deserve neither liberty / \ Email! nor safety. -- Benjamin Franklin ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
[freenet-support] Top 5 Indicators of Node Health?
I was wondering if someone could post a list of the top 5 (or top 10 if necessary) indicators that your node is healthy and reasonably busy, and a brief explanation of what those indicators are measuring. I'm thinking along the lines of specific items from the diagnostic values page, or node status interface, or failure table, etc. I'm learning more about Freenet every day, but I'd like to be able to quickly glance at some basic numbers to get a general understanding if there's something wrong that I should be diagnosing, or if things are at least working reasonably. ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
[freenet-support] DSL settings
When downloading through the regular Web my downloads typically run at 160 KB/sec. I'm wondering what the 'Node Bandwidth Limits' settings should be. The default configuration has set '0' for each of the three settings. Does this, in fact, mean "no fixed limit" (and should be left alone), or should I be setting 'Over All' to --say --100 KB/sec, or 'Output' to -- say -- 40 KB/s and 'Input' to '60 KB/s'? Are there any other important setting for DSL? Lastly, is my nodes list updated and saved automatically, or is there something I should be doing to improve my nodes list? Thanks very much for the replies I have received. Art PS. Things on FreeNet are a bit better today, but there sure appear to be a lot of dead links. I've been trying to find some movies or MP3's to download, but haven't succeeded thus far. ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Re: [freenet-support] DSL settings
On Wed, Nov 19, 2003 at 01:13:36PM -0800, Art Charbonneau wrote: When downloading through the regular Web my downloads typically run at 160 KB/sec. I'm talking PER FILE. There may be many simultaneous transfers. The main reason for this is that nodes typically run on ADSL, which typically has a grand total of 16kB/sec uplink bandwidth, and they will normally be transferring several files at once. If you are downloading a page with a bunch of images on, it's not unreasonable to expect 3kB/sec (once they get started) PER IMAGE, within your available bandwidth. A splitfile uses 30 simultaneous connections (or more) - 90kB/sec or more is not unheard of for large file downloads on Freenet. I'm wondering what the 'Node Bandwidth Limits' settings should be. The default configuration has set '0' for each of the three settings. Does this, in fact, mean no fixed limit (and should be left alone), or should I be setting 'Over All' to -- say -- 100 KB/sec, or 'Output' to -- say -- 40 KB/s and 'Input' to '60 KB/s'? No. The real default is 12kB/sec IIRC. You probably don't need an input limit. Are there any other important setting for DSL? Lastly, is my nodes list updated and saved automatically, or is there something I should be doing to improve my nodes list? It is saved automatically. Thanks very much for the replies I have received. Art PS. Things on FreeNet are a bit better today, but there sure appear to be a lot of dead links. I've been trying to find some movies or MP3's to download, but haven't succeeded thus far. -- Matthew J Toseland - [EMAIL PROTECTED] Freenet Project Official Codemonkey - http://freenetproject.org/ ICTHUS - Nothing is impossible. Our Boss says so. signature.asc Description: Digital signature ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
[freenet-support] 5032 FIW 0.07 - FEC Encoding problem?
When I'm trying to upload a site containing a large file (~ 150 Mb) with FIW 0.07, I get the following error message in FIW when generating FEC check chunks: [Error] unexpected error while building check chunks! This gets written to FIW log: java.net.SocketTimeoutException: Read timed out at java.net.SocketInputStream.socketRead0(Native Method) at java.net.SocketInputStream.read(Unknown Source) at java.io.BufferedInputStream.fill(Unknown Source) at java.io.BufferedInputStream.read(Unknown Source) at java.io.FilterInputStream.read(Unknown Source) at fiw.fcp.FCPUtil.readLine(FCPUtil.java:859) at fiw.fcp.FECUtil.makeFECData(FECUtil.java:245) at fiw.fcp.FECUtil.makeFECData(FECUtil.java:182) at fiw.core.jobs.FECBuilderJob.run(FECBuilderJob.java:83) at fiw.core.jobs.Job.run0(Job.java:132) at fiw.core.jobs.PooledThreadProducer$PooledThread.run(PooledThreadProducer.jav a:97) The following is spewed on the Freenet java console window: java.io.IOException: Sent 0 bytes (27 of packet in notifyDone at freenet.node.states.FCP.NewFECEncodeSegment.sendChunk(NewFECEncodeSeg ment.java:293) at freenet.node.states.FCP.NewFECEncodeSegment.sendDataChunks(NewFECEnco deSegment.java:276) at freenet.node.states.FCP.NewFECEncodeSegment.received(NewFECEncodeSegm ent.java:95) at freenet.node.StateChain.received(StateChain.java:192) at freenet.node.StateChain.received(StateChain.java:68) at freenet.node.StandardMessageHandler$Ticket.run(StandardMessageHandler .java:235) at freenet.node.StandardMessageHandler$Ticket.received(StandardMessageHa ndler.java:173) at freenet.node.StandardMessageHandler$Ticket.access$100(StandardMessage Handler.java:125) at freenet.node.StandardMessageHandler.handle(StandardMessageHandler.jav a:73) at freenet.Ticker$Event.run(Ticker.java:323) at freenet.thread.QThreadFactory$QThread.run(QThreadFactory.java:235) I can't find anything relevant in freenet.log when set to Normal logging level - I can try Debug if this will help, but it eats valuable HDD space _really_ quickly :-(, so I'm not sure if it will be able to log enough information before I'll have to start rotating log files. I can't verify at the moment if this is only relevant for build 5032, or any previous new stable builds are affected as well. If any additional information would help - I'll be happy to provide it. Is this a bug with FIW/Freenet or am I doing something stupid? Regards, Victor Denisov. ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
[freenet-support] Freenet Stable Build 5039
Freenet stable build 5039 is now available. Update your freenet node using update.sh, freenet-webinstall.exe, or the jar (save it over freenet.jar): http://freenetproject.org/snapshots/freenet-latest.jar . Don't forget to restart the node (you will need to shut it down before updating on Windows, but the rabbit icon may do this for you). This build turns off rejecting queries based on output bandwidth usage, a feature that is unnecessary (we have other ways of limiting bandwidth usage) and counterproductive to routing. We have been recently tweaking various settings to try to improve routing, reenabling it was an experiment, as there are several theories as to what exactly is going on on Freenet. It was useful, but we now think that disabling it will yield better routing. The corresponding unstable build is 6341. -- Matthew J Toseland - [EMAIL PROTECTED] Freenet Project Official Codemonkey - http://freenetproject.org/ ICTHUS - Nothing is impossible. Our Boss says so. signature.asc Description: Digital signature ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
