-----BEGIN PGP SIGNED MESSAGE----- Hash: SHA1
Has anyone noticed that when you use logfile rotation the dates in the filename are wrong?
i.e., Todays logfile is named freenet.log-2003-11-03-00
That is clearly a month behind. It has been happening since I turned on logfile rotation back on 29th October. Then the filename was freenet.log-2003-09-29-02 when I started the node up.
Richard - -- - ------------------------------------------------------------------------ CATGACGCACTAGCGGATTCCAATCGGGTAGTTCCCCCCGCGCACTTATGCCTCAATAGATCTGCCACATCG CATGGTGATCATCCCATTCTTCGCCCGGGATATCTTAAGCAATGGGGGAAGTGTGGCATCCTTTTGCTTCAG dna.pl v0.2.4 (c) 20020613 (tm) rich at mibnet.plus.com -----BEGIN PGP SIGNATURE----- Version: GnuPG v1.2.3-nr1 (Windows XP) Comment: Using GnuPG with Thunderbird - http://enigmail.mozdev.org
iD8DBQE/za0/DehCPPrjI9gRAmnSAJ4o5C83M89g7pWtP24N7Rxj9EVpNQCdF+Pp 1OxzAfQsTY7yV4lSltEJbTY= =oxdk -----END PGP SIGNATURE-----
-- ************************************************************************ This message has been swept clean of viruses by AVG Anti Virus email Scanner.
http://www.grisoft.com/html/us_index.cfm ************************************************************************ Checked by AVG anti-virus system (http://www.grisoft.com). Version: 6.0.541 / Virus Database: 335 - Release Date: 19/11/2003
_______________________________________________ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
