This is fixed in 6369 (in CVS, snapshots will be updated soon), and will also be fixed in the next stable build.
On Wed, Dec 03, 2003 at 09:30:40AM +0000, Richard Thomas Harrison wrote: > -----BEGIN PGP SIGNED MESSAGE----- > Hash: SHA1 > > Has anyone noticed that when you use logfile rotation the dates in the > filename > are wrong? > > i.e., Todays logfile is named freenet.log-2003-11-03-00 > > That is clearly a month behind. It has been happening since I turned on > logfile > rotation back on 29th October. Then the filename was > freenet.log-2003-09-29-02 > when I started the node up. > > Richard > - -- > - ------------------------------------------------------------------------ > CATGACGCACTAGCGGATTCCAATCGGGTAGTTCCCCCCGCGCACTTATGCCTCAATAGATCTGCCACATCG > CATGGTGATCATCCCATTCTTCGCCCGGGATATCTTAAGCAATGGGGGAAGTGTGGCATCCTTTTGCTTCAG > dna.pl v0.2.4 (c) 20020613 (tm) rich at mibnet.plus.com > -----BEGIN PGP SIGNATURE----- > Version: GnuPG v1.2.3-nr1 (Windows XP) > Comment: Using GnuPG with Thunderbird - http://enigmail.mozdev.org > > iD8DBQE/za0/DehCPPrjI9gRAmnSAJ4o5C83M89g7pWtP24N7Rxj9EVpNQCdF+Pp > 1OxzAfQsTY7yV4lSltEJbTY= > =oxdk > -----END PGP SIGNATURE----- > > > > -- > ************************************************************************ > This message has been swept clean of viruses by > AVG Anti Virus email Scanner. > > http://www.grisoft.com/html/us_index.cfm > ************************************************************************ > Checked by AVG anti-virus system (http://www.grisoft.com). > Version: 6.0.541 / Virus Database: 335 - Release Date: 19/11/2003 > > _______________________________________________ > Support mailing list > [EMAIL PROTECTED] > http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support -- Matthew J Toseland - [EMAIL PROTECTED] Freenet Project Official Codemonkey - http://freenetproject.org/ ICTHUS - Nothing is impossible. Our Boss says so.
signature.asc
Description: Digital signature
_______________________________________________ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
