Hello Peter and everyone, I was wondering if I could revive the discussion about the support of IG format if possible. I'm helping deploy EMBOSS at the US Patent and Trademark Office, where this format, in its multi-line sequence annotation form, is used extensively.
Here's an example of an additional issue I've run into when trying to work with IG format in EMBOSS: % makeprotseq -amount 10 -length 10 -nouseinsert -osformat ig -auto -osname ig1 % cat ig1.ig ;, 10 bases EMBOSS_001 hcsptpstas1 ;, 10 bases EMBOSS_002 rdgwcvmtrm1 ;, 10 bases EMBOSS_003 fgtifgdgid1 <snip> % entret -sequence ig1.ig:EMBOSS_001 -nofirstonly -auto -stdout ;, 10 bases EMBOSS_001 hcsptpstas1 ;, 10 bases In the entret result above the first annotation line of the subsequent record is returned as part of the requested record. Many thanks, Daniel -- Daniel Rozenbaum Biocceleration, Inc. OCIO/ Office of Application Engineering & Development/ Patent System Division 600 Dulany St. Alexandria VA 22314 ------------------------- On 15/08/2012 17:57, Daniel Rozenbaum wrote: > Dear list, > > (Peter, many thanks for your prompt reply to my previous inquiry!) > > We need to deal with extensive databases in Intelligenetics format with > multiple lines in annotation of each record. It appears however that EMBOSS > concatenates all annotation lines into a single line when building its > internal representation of the sequence description: > > % cat /tmp/IGSEQ.ig > ; Annotation line 1 > ; Annotation line 2 > ; Annotation line 3 > IGSEQ > ACGCATCGCATCAGACTACGC1 > > > % seqret /tmp/IGSEQ.ig -osformat2 ig -auto -osname IGSEQ.emboss_ig2ig > -osdirectory /tmp > > > % cat /tmp/IGSEQ.emboss_ig2ig.ig > ;Annotation line 1 Annotation line 2 Annotation line 3, 21 bases > IGSEQ > ACGCATCGCATCAGACTACGC1 > > Are there any plans to support multi-line annotation in this format? Interesting thought. We will take a look. It will need some care to maintain compatibility with other formats that have single (FASTA) or multiple (swissprot) descriptions. Which package is using this IG format? regards, Peter Rice EMBOSS Team _______________________________________________ EMBOSS mailing list EMBOSS@lists.open-bio.org http://lists.open-bio.org/mailman/listinfo/emboss
