On Mon, 2010-01-25 at 14:05 -0800, Lu Wang wrote:
Hi,
I tried to use the following commands to create a postscript pie chart using
R:
postscript(file=H:/piechart.eps)
# then I wrote my commands to generate the pie chart
pie(filename,labels=,col=,radius=0.6)
dev.off()
After I ran
2010/1/26 Ben Bolker bol...@ufl.edu
julien martin julemartin0320 at gmail.com writes:
I am generating 1000 replicate data sets in R, each data set is then
analyzed with WinBUGS in batch mode using R2WinBUGS. Unfortunately,
occasionally some data sets lead WinBUGS to open a trap window;
Dear All
I have data as follows.
D TM L
0.20 1 03 141
0.321 07 62
0.50 1 05 49
0.80 1 04 46
0.20 2 14 130
0.322 17 52
0.50 2 13 41
0.80 2 14
On 25.01.2010 11:03, richard.kie...@rwe.com wrote:
Hi!
You have probably sorted out your problem a different way.
However I have tried dealing with the same problem for a while and writing down
the reason for this here may be of use to someone.
In some other help-mail I read that time
Maybe that's a problem with the RSQLite package , probably detaching
the package help.
detach(package:RSQLite)
HTH, Christian
trying to structure sql to merge two datasets. structure follows:
dbs.possible.combos (all possible combinations of dates and places)
Date Place
1/1/10 N-01
1/1/10
Dear all,
Thanks for the replies so far.
Just to emphasise, I'm not using Excel in any way. I have many many files to
output, so it'd take considerable time to export from R, reprocess in Excel,
then load into Arc! On a PC I'm able to go directly from R to ArcMap (9.3)
without having to go
No problem!
Working:
z-ts(sin(1:1000), start=1, freq=10)
x-StructTS(z, type='BSM')
Hang:
z-ts(sin(1:1000), start=1, freq=100)
x-StructTS(z, type='BSM')
(Both on WinXP, R 2.9.2)
I don't, however, know who the package maintainer is, nor can I track down
where exactly the hang is caused.
Maybe
On 01/26/2010 01:52 AM, Andreas Bergstrøm wrote:
Greetings,
I am attempting to use R throug PL/R in PostgreSQL to make several graphs (they
show usage over time for radiochannels).
However, as some never go above 100 in a 24 hour period, and others go well
over 500, they get different y-axis
Sorry mistake from me. This was another problem in my mind , but with
RMySQL.
Christian
library(RMySQL)
library(sqldf)
sqldf(Select * from mtcars)
Fehler in mysqlNewConnection(drv, ...) :
RS-DBI driver: (Failed to connect to database: Error: Access denied
for user 'user'@'localhost' (using
On 26.01.2010 10:55, richard.kie...@rwe.com wrote:
No problem!
Working:
z-ts(sin(1:1000), start=1, freq=10)
x-StructTS(z, type='BSM')
Hang:
z-ts(sin(1:1000), start=1, freq=100)
x-StructTS(z, type='BSM')
(Both on WinXP, R 2.9.2)
I don't, however, know who the package maintainer is, nor can I
On Tue, Jan 26, 2010 at 11:42 AM, Steve Murray smurray...@hotmail.comwrote:
Dear all,
Thanks for the replies so far.
Just to emphasise, I'm not using Excel in any way. I have many many files
to output, so it'd take considerable time to export from R, reprocess in
Excel, then load into
I still struggling with this:
error massage:
by(AlexETF,AlexETF$Industry,function(a) {filename = paste(C:/ab/,gsub(
,,a$Industry[1]),.txt,sep=)
+ print(filename)
+ write.table(a[,3,drop=FALSE],quote=FALSE,col.names=FALSE,row.names=FALSE)
+ }
+ )
[1]
On 26. jan. 2010, at 11:07, Jim Lemon wrote:
On 01/26/2010 01:52 AM, Andreas Bergstrøm wrote:
Hi Andreas,
I didn't see an answer to your question, so I'll suggest that you take these
warnings seriously:
Warning messages:
1: In plot.window(...) : ylim.max is not a graphical parameter
2:
On Sun, Jan 24, 2010 at 10:09 AM, Barry Rowlingson
b.rowling...@lancaster.ac.uk wrote:
After accusing someone of typing 'install.packages(weather)' instead
of 'install.packages(webmaps)', I discovered that R-forge really is
currently returning the wrong source tarball for packages after
Peter Rote wrote:
I still struggling with this:
error massage:
by(AlexETF,AlexETF$Industry,function(a) {filename = paste(C:/ab/,gsub(
,,a$Industry[1]),.txt,sep=)
+ print(filename)
+ write.table(a[,3,drop=FALSE],quote=FALSE,col.names=FALSE,row.names=FALSE)
+ }
+ )
On 01/26/2010 09:15 PM, Peter Rote wrote:
I still struggling with this:
error massage:
by(AlexETF,AlexETF$Industry,function(a) {filename = paste(C:/ab/,gsub(
,,a$Industry[1]),.txt,sep=)
+ print(filename)
+ write.table(a[,3,drop=FALSE],quote=FALSE,col.names=FALSE,row.names=FALSE)
You are rigth Bert.
Thanks for the clarification.
On Mon, Jan 25, 2010 at 7:00 PM, Bert Gunter gunter.ber...@gene.com wrote:
I think that careful examination will show that Henrique's solution is not
quite right: the text '=' character is slightly different than the symbol
font character.
Exponential, you say?
Maybe I am just not patient enough.
After being unresponsive for several minutes, which in the larger examples that
I work with has probably appeared like a hang, the code I just mentioned has
given a result (a convergence error, but still).
So, I must say I can no longer
Hello
I'm analyzing a dichotomous dependent variable (dv) with more than 100
measurements (within-subjects variable: hours24) per subject and more
than 100 subjects. The high number of measurements allows me to model
more complex temporal trends.
I would like to compare different models
I'm trying to typeset at simple crosstable with the Hmisc latex function. And I
have two problems.
1. How do I make all columns the same width? The Latex function seems very
unwilling to break the 'cgroup' labels and the factor level labels. Please have
look at this screenshot that shows my
On 26.01.2010 11:52, richard.kie...@rwe.com wrote:
Exponential, you say?
Maybe I am just not patient enough.
After being unresponsive for several minutes, which in the larger examples that
I work with has probably appeared like a hang, the code I just mentioned has
given a result (a
Yes, R thinks the coordinates are characters, that needs to change. Also,
alternatively you could use the write .dbf function in the foreign()
library, ArcGis likes dbf files (just no long names)
Corey
-
Corey Sparks, PhD
Assistant Professor
Department of Demography and Organization
Hello there, I want to create a string from strings and numbers, here is my
code:
str - name toString(20)
but it returns me this error:
Error in toString(20) : could not find function .jcall
what did I do wrong? I couldn't find this error anywhere...
--
View this message in context:
Dear all,
Just to let you know that thanks to your help, I've managed to solve it.
For future reference, if anyone's interested (!), if you're having problems
reading R-generated data from a Mac, into ArcMap on a PC, then ensure that
you're using eol=\r\n in the write.table command and that
Hi Stefan,
See comments in line below.
On Tue, Jan 26, 2010 at 6:21 AM, Stefan Petersson
stefan.peters...@inizio.se wrote:
I'm trying to typeset at simple crosstable with the Hmisc latex function. And
I have two problems.
1. How do I make all columns the same width?
Use
Hi all I want to apply different colors on a simple plot:
If I type par(br=gray) before a plot it puts all the image in gray but
(imagine I run a simple plot) want to let the centrall box (where the dots
are plotted) in white or image in lightblue.
Can anyone guide me to apply this second step
On 01/26/2010 03:09 PM, anna wrote:
Hello there, I want to create a string from strings and numbers, here is my
code:
str- name toString(20)
Where did you get that syntax from ? You need to use paste.
paste( name, 20 )
[1] name 20
but it returns me this error:
Error in toString(20) :
Hi,
update.packages(ask='graphics')
gives me multiple warning (one per updated package?) similar to ...
Warning: unable to move temporary installation
'\\Server02\stats\R\library\2.10\file3de56e0d\locfit' to
'\\Server02\stats\R\library\2.10\locfit'
The final, updated, folders do not end
Hi, I need to read a string vector in R which is like this
atgctctaatcgtcccaacaattatattactaccac, but R seems to understand it as
a unique vector input when I read in like x -
atgctctaatcgtcccaacaattatattactaccac. How do I unconcatenate it, so I
can use each of the letters on my reading?
Dear list users,
I modeled the probability of occurrence of one species: Cyperus
dilatatus.
I modeled the species using three different approaches:
c(random,target,index)
What I want to achieve is to make a plot of all prediction maps in a row
with to conditional variables, that is, with the
?paste
is a logical operator, not string concatenation.
On Tue, Jan 26, 2010 at 9:09 AM, anna lippelann...@hotmail.com wrote:
Hello there, I want to create a string from strings and numbers, here is my
code:
str - name toString(20)
but it returns me this error:
Error in toString(20) :
Like this?
strsplit(atgctctaatcgtcccaacaattatattactaccac, split=)
-Ista
On Tue, Jan 26, 2010 at 8:08 AM, bia.estat bia@live.com wrote:
Hi, I need to read a string vector in R which is like this
atgctctaatcgtcccaacaattatattactaccac, but R seems to understand it as
a unique vector
On 01/26/2010 02:08 PM, bia.estat wrote:
Hi, I need to read a string vector in R which is like this
atgctctaatcgtcccaacaattatattactaccac, but R seems to understand it as
a unique vector input when I read in like x-
atgctctaatcgtcccaacaattatattactaccac. How do I unconcatenate it, so I
can
name toString(20)
is from Excel or OpenOffice; means 'logical and' in R, not string
concatenation.
paste() is simpler; sprintf() is more precise as to decimal places and
format.
anna lippelann...@hotmail.com 26/01/2010 14:09:15
Hello there, I want to create a string from strings and
thanks! I thought it was a concatenator like in vb
--
View this message in context:
http://n4.nabble.com/Error-with-toString-tp1290327p1292949.html
Sent from the R help mailing list archive at Nabble.com.
__
R-help@r-project.org mailing list
Romain, I used the paste for numbers to as you told me and it worked. For the
toString() function well I called it from the R console and that's what it
returned me...
--
View this message in context:
http://n4.nabble.com/Error-with-toString-tp1290327p1293039.html
Sent from the R help mailing
Try mapping a drive letter to \\Server02 and then use that. For more,
google for: map network drive
On Tue, Jan 26, 2010 at 10:01 AM, Keith Jewell k.jew...@campden.co.uk wrote:
Hi,
update.packages(ask='graphics')
gives me multiple warning (one per updated package?) similar to ...
On 01/26/2010 04:19 PM, anna wrote:
Romain, I used the paste for numbers to as you told me and it worked. For the
toString() function well I called it from the R console and that's what it
returned me...
Yes. I understood that the first time. and I asked you to provide more
details about your
Dear All,
I have a large data set that looks like this:
CVX 20070201 9 30 51 73.25 81400 0
CVX 20070201 9 30 51 73.25 100 0
CVX 20070201 9 30 51 73.25 100 0
CVX 20070201 9 30 51 73.25 300 0
First, I would like to import it by merging column 3 4 and 5, since that is
the timestamp. Then, I would
hello,
I have a problem to open an hdf file. i have downloaded the package 'hdf5' as
it was advised on R seek. But when i try to load the file, the R console sends
me an eror message:
setwd(C:/Documents and Settings/Karine/Bureau/data/)
#install.packages('hdf5')
library(hdf5)
sea_ice
Try this:
strsplit(atgctctaatcgtcccaacaattatattactaccac, NULL)
On Tue, Jan 26, 2010 at 11:08 AM, bia.estat bia@live.com wrote:
Hi, I need to read a string vector in R which is like this
atgctctaatcgtcccaacaattatattactaccac, but R seems to understand it as
a unique vector input
I'm trying to use the package ARES to produce allelic richness
estimates with extrapolation beyond the sample size. I've begun by
testing the program with the butterfly_borneo data provided with the
package, but I seem to be having a problem with the read.genepop
function. Below, I've included
Hi,
I'm trying to create a heatmap with color ranges for different values in my
matrix. For example:
If x 5 , use orange gradient
if x 1.5, use red gradient
.
Right now I have the following:
orgPal-brewer.pal(3,Oranges)
bluPal-brewer.pal(3,Blues)
redPal-brewer.pal(3,Reds)
grad -
In the area plots below, I see 4 triangle ticks at both sides of the bar; I
believe these are non-stacked values for p, but they are definitively
confusing.
In addition, I would like to get the order of the colors in the plot the
same as in the legend, and not arranged alphabetically (the factor
Hi Dieter,
It looks like a bug:
Order works fine with bars:
qplot(factor(dur),weight=p,data=cf1, fill=score, geom = bar, order =
rev(score))
but not with areas:
qplot(dur, p, data=cf1, fill=score, geom = area, order = rev(score))
I'll add it to my to do list.
Hadley
On Tue, Jan 26, 2010 at
Try this using the development version of read.zoo in zoo (which we
source from the R-Forge on the fly).
We use NULL in colClasses for those columns we don't need but in
col.names we still have to include dummy names for
them. Of what is left the index is the first three columns (1:3)
which we
Dear R-users,
I am working with R version 2.10.1.
Say I have is a simple function like this:
my.fun - function(x, mult) mult*sum(x)
Now, I want to apply this function along with some other (say 'max') to a
simple data.frame, like:
dat - data.frame(x = 1:4, grp = c(a,a,b,b))
Ideally, the
Thanks Gabor, but expanding on my remark...
I can work around by mapping a drive letter to the '//server/share', but
prefer not to (for local reasons).
R is installed on our network, used by others (with readonly access),
maintained by me.
In 'Renviron.site' I have...
Dear all,
My script returns the following error:
Error in storage.mode(test) - logical :
(list) object cannot be coerced to type 'double'
I've looked around and some suggest that it could be the way data have been
imported. For my case, I don't think it is such. Rather I think it has to be
On 1/26/10 2:11 AM, Christian Schulz wrote:
Sorry mistake from me. This was another problem in my mind , but with
RMySQL.
Christian
library(RMySQL)
library(sqldf)
sqldf(Select * from mtcars)
Fehler in mysqlNewConnection(drv, ...) :
RS-DBI driver: (Failed to connect to database: Error:
Hi,
I expect that if I change only the resolution of an image, although the
image would have more pixels, if viewed in the same physical size, the
elements in the image would have the same physical size but with more
detail. However, when I use the res parameter of png() this is not
what I
Hi, Hadley,
can you also reproduce the âtrianglesâ problem? Is it just a trivial
corollary of the order-bug?
Dieter
From: hadley wickham [via R] [mailto:ml-node+1294703-876505...@n4.nabble.com]
Sent: Tuesday, January 26, 2010 5:18 PM
To: Dieter Menne
Subject: Re: [R] Strange
On Tue, Jan 26, 2010 at 11:55 AM, Seth Falcon s...@userprimary.net wrote:
That sqldf only works if RMySQL is not attached seems like something worth
investigating and fixing. It should be possible to avoid such conflicts by
proper use of name spaces, but I have not looked into the details of
If I understand what you want correctly, you'll probably want to use the
col argument in whatever base graphics function you're using, rather than
changing something in the graphical parameters. For example, if I wanted to
add red points to an existing plot, I would use something like
Hi all, I'm just getting started in R so bear with my newbness.
I am trying to create a very simple histogram of logins by time, with data
coming in from a MYSQL query.
the raw data looks like this:
id user_id experience_given created_at ip_aton
1 XXX 2445626 0 2010-01-21 00:00:01 1123632036
You can use the rbinom function to generate the random data. What to feed that
function depends on things that you did not state (is this a comparison of 2
groups?, a logistic regression?, etc.).
--
Gregory (Greg) L. Snow Ph.D.
Statistical Data Center
Intermountain Healthcare
Something along these lines might do the trick:
orig - rep(sapply(seq(from=, to=, by=),
as.character), times=c(1, 2, 3, 4))
I've shortened the number of repetitions, so you can test it out and see if
it's what you're looking for (just change the values in the vector
Try replacing 'max' with 'mean' and see what you get.
Then have a look at ?max and see what max() does with
extra arguments.
I'm not sure it's relevant, but it might be useful
to check what Hmisc::summarize does.
-Peter Ehlers
RINNER Heinrich wrote:
Dear R-users,
I am working with R version
Hi, Hadley,
In case you have a temporary workaround, it would be nice to have it. Itâs a
show stopper for my report. Bars are not an option, because the curve looks too
jaggy.
âDieter
From: hadley wickham [via R] [mailto:ml-node+1294703-876505...@n4.nabble.com]
Sent:
Dear All I hope that someone can help.
I am working with sp pakage and akima
library(akima)
library(sp)
imagine lots of different dataframes, of row = 100 columns = 3 of x and y
coordinates with z values I will call these data frames for the sake of this
example akima
akima-as.list(1:100)
evgeny55 wrote:
I'm trying to create a heatmap with color ranges for different values in
my matrix. For example:
If x 5 , use orange gradient
if x 1.5, use red gradient
.
Right now I have the following:
orgPal-brewer.pal(3,Oranges)
bluPal-brewer.pal(3,Blues)
Matthew Walker wrote:
I expect that if I change only the resolution of an image, although the
image would have more pixels, if viewed in the same physical size, the
elements in the image would have the same physical size but with more
detail.
The sample you provided create figures
Hi:
Using the plyr package, we can get the result as follows:
library(plyr)
my.fun - function(x, mult) mult*sum(x)
dat - data.frame(x = 1:4, grp = c(a,a,b,b))
ddply(dat, .(grp), summarize, max = max(x), myfun = my.fun(x, 10))
grp max myfun
1 a 230
2 b 470
HTH,
Dennis
On
as a followup, I tried using the rainbow function to create the gradients but
is there a way to do a reverse rainbow, ie. normally if I do:
pie(rep(1,6), col=rainbow(6,start=0, end=.07))
I'll get a gradient from dark red to orangish but what if I want it to go
the other way
thanks
--
View
stefan.petersson wrote:
I'm trying to typeset at simple crosstable with the Hmisc latex function.
And I have two problems.
1. How do I make all columns the same width? The Latex function seems very
unwilling to break the 'cgroup' labels and the factor level labels. Please
have look at
If you need more aggregations on the stock (I assume that's what the
first column is), I'd use the data.table package. It allows fast
indexing and merge operations. That's handy if you have other features
of a stock (like company size or industry sector) that you'd like to
include in the
stefan.petersson wrote:
I'm trying to typeset at simple crosstable with the Hmisc latex function.
And I have two problems.
1. How do I make all columns the same width? The Latex function seems very
unwilling to break the 'cgroup' labels and the factor level labels. Please
have look at
Dieter Menne wrote:
Matthew Walker wrote:
I expect that if I change only the resolution of an image, although the
image would have more pixels, if viewed in the same physical size, the
elements in the image would have the same physical size but with more
detail.
The sample you
thanks, it was exactly what i needed.
--
View this message in context:
http://n4.nabble.com/reading-a-string-vector-tp1290289p1310721.html
Sent from the R help mailing list archive at Nabble.com.
__
R-help@r-project.org mailing list
No mate,
Sorry first of all about my indefinition (I´m Spanish, I´m improving
everyday but a long road to the perfection). Sorry pleae.
Second, also it is diffcoult sometimes to express what we try (sorry and
many thanks just for reading of course for helping).
Imagine you plot
X=[2 4 6 8]
Hello R buddies, I want to apply a function on an array but for each element
of the array I want to use a different parameter, So here is how I tried to
enter the function:
apply(as.matrix(X),2, function, parameter1 = arrayOfParameter)
I put X as a matrix because it was initially an element of a
Hi,
Try this,
x - seq(0, 10, len = 100)
y - jitter(sin(x), 1000)
old.par - par()
par(bg=grey(0.5))
plot(x, y, new = TRUE, t = n)
lims - par(usr)
plot(x, y, col = 1,
panel.first = {
rect(lims[1], lims[3], lims[2], lims[4],
col = lightblue) })
HTH,
baptiste
2010/1/26
-Original Message-
From: r-help-boun...@r-project.org [mailto:r-help-boun...@r-project.org] On
Behalf Of anna
Sent: Tuesday, January 26, 2010 11:48 AM
To: r-help@r-project.org
Subject: [R] Apply a function on an array with the parameter as an array
Hello R buddies, I want to apply a
No the posting guide is quite big and I wanted to take time to read it
properly, since I have been posting seriously since last wednesday and I
work a lot I didn't get time to do it but will do it now ;). So you say that
you know exactly what I tried to do can you explain what I tried to do if
I perhaps should have added that the etiquette of this list is to supply
your correct name in your signature. This does not necessarily mean that you
will be ignored if you fail to do so, but it does increase the likelihood
that you will be.
Bert Gunter
Genentech Nonclinical Biostatistics
Speaking **only for myself**, if you don't have the time to read and follow
the posting guide, I don't have the time to try to help you.
Bert Gunter
Genentech Nonclinical Biostatistics
__
R-help@r-project.org mailing list
Sorry! I am reading it now!
--
View this message in context:
http://n4.nabble.com/Apply-a-function-on-an-array-with-the-parameter-as-an-array-tp1310834p1310856.html
Sent from the R help mailing list archive at Nabble.com.
__
R-help@r-project.org
Roslina Zakaria wrote:
newton.inputsingle - function(pars,n)
{ runi - runif(974, min=0, max=1)
lendt - length(runi)
## Parameter to estimate
z - vector(length=lendt, mode= numeric)
z - pars[1]
## Constant value
alp - 2.0165 ; rho - 0.868;
c
Yesterday I posted the following question (my apologies for not putting a
subject line):
=question==
Hello -- I would like to know of a more efficient way of writing the following
piece of code. Thanks.
options(stringsAsFactors=FALSE)
orig -
Yesterday I posted the following question (my apologies for not putting a
subject line):
=question==
Hello -- I would like to know of a more efficient way of writing the following
piece of code. Thanks.
options(stringsAsFactors=FALSE)
orig -
Yesterday I posted the following question (my apologies for not putting a
subject line):
=question==
Hello -- I would like to know of a more efficient way of writing the following
piece of code. Thanks.
options(stringsAsFactors=FALSE)
orig -
Hi Dennis,
now that's a very nice function, and this seems to be just what I need!
Thanks a lot!
-Heinrich.
Von: Dennis Murphy [djmu...@gmail.com]
Gesendet: Dienstag, 26. Januar 2010 19:44
An: RINNER Heinrich
Cc: r-help
Betreff: Re: [R] tapply and more than
I am having trouble plotting outliers on time series.
Give then following code:
# find STL Outliers by weight and append sh2, use Robust
# this should allow the initial outliers to be filtered
# this section may be commented out.
can you also reproduce the “triangles” problem? Is it just a trivial
corollary of the order-bug?
The triangles are there because you have a layer of points (from the
qplot default) and layer of areas. Setting geom = area in qplot
fixes that.
Hadley
--
http://had.co.nz/
In case you have a temporary workaround, it would be nice to have it. It’s a
show stopper for my report. Bars are not an option, because the curve looks
too jaggy.
I just remember that to work around the problem, you can just manually
order the data frame:
cf1 - cf1[with(cf1, order(dur,
Ok, I read the entire posting guide and updated my signature. So I come back
on my question, should I use an apply in an apply to make this?
-
Anna Lippel
--
View this message in context:
Hi All,
I have a problem cbind two vectors one is a numeric and the other is an
mpfr object and then saving the result into a .csv file. I am unable to save
the mpfr vector into .csv file . here is the error that I get
Error in as.data.frame.default(x[[i]], optional = TRUE) :
cannot coerce
Has there been any update on R's handling large integers greater than 10^9
(between 10^9 and 4x10^9) ?
as.integer() in R 2.9.2 lists this as a restriction but doesnt list the actual
limit or cause, nor if anyone was looking at fixing it.
Glenn D Blanford, PhD
mailto:glenn.blanf...@us.army.mil
On 26/01/2010 3:25 PM, Blanford, Glenn wrote:
Has there been any update on R's handling large integers greater than 10^9
(between 10^9 and 4x10^9) ?
as.integer() in R 2.9.2 lists this as a restriction but doesnt list the actual
limit or cause, nor if anyone was looking at fixing it.
I have just upgraded from 2.9.2 to 2.10.1 on my XP machine.
I rec'd the following error message:
Error in strsplit(x[ok], [.-]) :
5 arguments passed to .Internal(strsplit) which requires 6
I also tried update.packages(checkBuilt=TRUE, ask = FALSE)
update.packages(checkBuilt=TRUE,
You can do something like this:
lapply(1:nrow(X), function(.indx, param){
X[.indx,] * param[.indx] # apply param[i] to row i of X
}, param=arrayOf Params)
On Tue, Jan 26, 2010 at 3:52 PM, anna lippelann...@hotmail.com wrote:
Ok, I read the entire posting guide and updated my signature.
On 26.01.2010 22:09, steve_fried...@nps.gov wrote:
I have just upgraded from 2.9.2 to 2.10.1 on my XP machine.
I rec'd the following error message:
Error in strsplit(x[ok], [.-]) :
5 arguments passed to .Internal(strsplit) which requires 6
I also tried update.packages(checkBuilt=TRUE,
Hi,
I am looking for some tips on how to incorporate known measurement error into
the comparison of slopes in an analysis of covariance. Specifically, if I
know that each measurement comes with a 5% error, is it possible to 'expand'
the confidence intervals around the estimates for the slope
Hi,
Can anyone guide me as to how I can add points to a p3d() plot from
the onion package? I want to plot points with different colors on the
same 3D plot. Perhaps I can do this without adding points but somehow
directing the 'h' parameter to give different color to points based on
a factor I
Hi All,
My R installation is acting strangely and I'm hoping somebody might have
an idea what's going on:
I can't seem to load the RMySQL function. It seems to have installed
without a problem, but when I enter:
library(RMySQL)
R tells me:
Error in utils::readRegistry(SOFTWARE\\MySQL AB,
On 26/01/2010 4:54 PM, Jonathan wrote:
Hi All,
My R installation is acting strangely and I'm hoping somebody might have
an idea what's going on:
You need to give more details. Which R version? (If less than 2.10.1,
install that and try again.) Do you have MySQL installed on that
hi, i'm having some trouble getting a package to load a shared library
object in .onLoad(...)
i have a shared object file, say mylib.so.
if i start an R session, and via the CLI specify the actual library
via:
dyn.load(mylib.so)
everything works quite well (i.e. i can then follow with some
to clarify the example a bit, assume that for lib.loc i always want to
search the current working directory of the R session (thus forcing
the user to have mylib.so sitting in the directory returned by getwd()
when loading the package).
NOTE: this is not how i will finally implement this package,
thanks,
I think I got the color ranges down, however, I just realized that the
colors don't match the data. When I execute:
grad - ifelse(randMat 5,yelPal,ifelse(randMat1.5,redPal,bluPal))
the grad matrix contains the correct hex codes corresponding to the randMat
data matrix but when I
also, can you point me to some example of how to omit colors from a palette
--
View this message in context:
http://n4.nabble.com/heatmap-2-color-range-tp1293498p1311031.html
Sent from the R help mailing list archive at Nabble.com.
__
1 - 100 of 123 matches
Mail list logo
