Hi, I need to read a string vector in R which is like this
atgctctaatcgtcccaacaattatattactaccac, but R seems to understand it as
a unique vector input when I read in like x -
atgctctaatcgtcccaacaattatattactaccac. How do I unconcatenate it, so I
can use each of the letters on my reading?
Like this?
strsplit(atgctctaatcgtcccaacaattatattactaccac, split=)
-Ista
On Tue, Jan 26, 2010 at 8:08 AM, bia.estat bia@live.com wrote:
Hi, I need to read a string vector in R which is like this
atgctctaatcgtcccaacaattatattactaccac, but R seems to understand it as
a unique vector
On 01/26/2010 02:08 PM, bia.estat wrote:
Hi, I need to read a string vector in R which is like this
atgctctaatcgtcccaacaattatattactaccac, but R seems to understand it as
a unique vector input when I read in like x-
atgctctaatcgtcccaacaattatattactaccac. How do I unconcatenate it, so I
can
Try this:
strsplit(atgctctaatcgtcccaacaattatattactaccac, NULL)
On Tue, Jan 26, 2010 at 11:08 AM, bia.estat bia@live.com wrote:
Hi, I need to read a string vector in R which is like this
atgctctaatcgtcccaacaattatattactaccac, but R seems to understand it as
a unique vector input
thanks, it was exactly what i needed.
--
View this message in context:
http://n4.nabble.com/reading-a-string-vector-tp1290289p1310721.html
Sent from the R help mailing list archive at Nabble.com.
__
R-help@r-project.org mailing list
5 matches
Mail list logo