Dear Henrik,
Thank you very much for your time and for your answers, they have been
extremely useful.
We are looking at different possibilities for the comparison between
NGS and the exon array, also at the gene and exon-levels as you
propose, so we would like to have as many options as possible.
Regarding the cross-hybridazation and the GC content, I know there are
models for differential splicing that work on probe intensities rather
than on exon intensities - the ANOSVA model, for example - so maybe I
can find something useful there.
Once again, thanks a lot.
Best regards,
María
On Jul 12, 2:38 am, Henrik Bengtsson <henrik.bengts...@aroma-
project.org> wrote:
> Hi.
>
> On Sun, Jul 10, 2011 at 11:05 PM, Maria Rodrigo-Domingo
>
>
>
>
>
>
>
>
>
> <mrod...@gmail.com> wrote:
> > Hi Henrik,
>
> > Thanks a lot for your reply.
>
> > I am aware that probes/cells are not annotated just like probesets or
> > transcript clusters, so I just didn't explain my problem properly. I
> > have already done the analysis at the exon and transcript level using
> > your ExonRmaPlm() with mergeGroups=TRUE or FALSE for each case so that
> > part of the analysis, the one most people are interested in, is fine.
>
> > I am interested in mapping intensities to sequences of nucleotides: I
> > have downloaded Affymetrix's library files and in one of them one can
> > find the target sequence corresponding to each "probe identity/index"
> > - from 1 to 6.5 million - that can be uniquely obtained using the
> > (x,y) coordinates of the probe on the cdf file.
>
> I'm not 100% sure I know what your asking for, but maybe the following
> helps. When doing:
>
> Y <- extractMatrix(csN, cells=cells, field=c("intensities", "stdvs",
> "pixels"), drop=FALSE, verbose=verbose);
>
> the returned Y is a JxI matrix, where J is the number of cells
> requested (==length(cells)) and I is the number of arrays
> (==nbrOfArrays(csN)). Argument 'cells' is an index vector specifying
> the cells for which the intensities should be retrieved. If NULL,
> it's the same as cells <- 1:nbrOfArrays(csN). You can specify any
> subset or order you'd like - the rows of Y will be ordered
> accordingly.
>
> So, with the above you will know the cell index for each row in Y.
> From the cell index you can obtain the one-to-one (x,y) cell
> coordinate (see my previous message). With (x,y) it sounds like you
> can retrieve the target sequence you'd like from Affymetrix or other
> annotation data sources - is that correct? If this is not enough, I'm
> not sure what kind of mapping you're looking for.
>
> If you are interested in the 25-mer *probe* sequences, they are
> readily available in the Aroma Cell Sequence (ACS) file:
>
> http://aroma-project.org/chipTypes/HuEx-1_0-st-v2
>
> For example:
>
> > cdf <- getCdf(csN);
> > acs <- getAromaCellSequenceFile(cdf);
> > acs
>
> AromaCellSequenceFile:
> Name: HuEx-1_0-st-v2
> Tags: HB20080710
> Full name: HuEx-1_0-st-v2,HB20080710
> Pathname:
> annotationData/chipTypes/HuEx-1_0-st-v2/HuEx-1_0-st-v2,HB20080710.acs
> File size: 162.50 MB (170394012 bytes)
> RAM: 0.00 MB
> Number of data rows: 6553600
> File format: v1
> Dimensions: 6553600x26
> Column classes: raw, raw, raw, raw, raw, raw, raw, raw, raw, raw, raw, raw,
> raw,
> raw, raw, raw, raw, raw, raw, raw, raw, raw, raw, raw, raw, raw
> Number of bytes per column: 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1,
> 1, 1
> , 1, 1, 1, 1, 1, 1, 1, 1
> Footer: <createdOn>20080710 22:05:44
> PDT</createdOn><platform>Affymetrix</platfo
> rm><chipType>HuEx-1_0-st-v2</chipType><srcFile><filename>HuEx-1_0-st-v2.probe.ta
> b</filename><filesize>553438704</filesize><checksum>1ff5d5bd59bd7345ecbab1973097
> 247e</checksum></srcFile>
> Chip type: HuEx-1_0-st-v2
> Platform: Affymetrix
>
> > cells <- c(1024, 10902:10905);
> > readSequences(acs, cells=cells)
>
> [1] "CCTGCTGGTATCCTGGGAACCAGGT" "ATTATTTGAATGGAGATGGTTACAT"
> [3] "TTTGTGGTTTAGAATGTCAGCCCAT" "TAGTGGTTGCCATAAGTCTTACCAT"
> [5] NA
>
> As you see, all sequences are not known, but several are. You can
> also retrieve the probe sequence data in other ways, e.g.
>
> > readSequenceMatrix(acs, cells=cells)
>
> [,1] [,2] [,3] [,4] [,5] [,6] [,7] [,8] [,9] [,10]
> [1,] "C" "C" "T" "G" "C" "T" "G" "G" "T" "A"
> [2,] "A" "T" "T" "A" "T" "T" "T" "G" "A" "A"
> [3,] "T" "T" "T" "G" "T" "G" "G" "T" "T" "T"
> [4,] "T" "A" "G" "T" "G" "G" "T" "T" "G" "C"
> [5,] NA NA NA NA NA NA NA NA NA NA
> [,11] [,12] [,13] [,14] [,15] [,16] [,17] [,18] [,19]
> [1,] "T" "C" "C" "T" "G" "G" "G" "A" "A"
> [2,] "T" "G" "G" "A" "G" "A" "T" "G" "G"
> [3,] "A" "G" "A" "A" "T" "G" "T" "C" "A"
> [4,] "C" "A" "T" "A" "A" "G" "T" "C" "T"
> [5,] NA NA NA NA NA NA NA NA NA
> [,20] [,21] [,22] [,23] [,24] [,25]
> [1,] "C" "C" "A" "G" "G" "T"
> [2,] "T" "T" "A" "C" "A" "T"
> [3,] "G" "C" "C" "C" "A" "T"
> [4,] "T" "A" "C" "C" "A" "T"
> [5,] NA NA NA NA NA NA
> attr(,"map")
> <NA> A C G T
> 00 01 02 03 04
>
> > The reason is that I
> > would like to compare the performance of Exon arrays to NGS and that's
> > why the individual probes are so important for me. So my question is
> > whether it is possible to perform an analysis at the "sequence level".
>
> To " perform an analysis at the "sequence level" " is rather vague -
> it sounds like a research project in itself. To compare arrays and
> NGS estimates, why not compare at the summaries transcript of exon
> levels? (Also, make sure to search the literature for studies
> comparing exon arrays with NGS).
>
>
>
> > Yet another question, maybe too general, I have also noticed that in
> > some cases the 4 probes interrogating the same exon (Probe Selection
> > Region) have extremely different intensities. Do you think it is a
> > consequence of the GC content of the individual probes or would you
> > blame it on cross-hybridazation? Would you somehow correct the probe
> > intensities by their GC content?
>
> I'm sure there is no simple answer, but if you look at the early
> Affymetrix gene-expression papers (dChip, RMA, ...) you'll find that
> so called "probe affinities" are substantial. There has been heaps of
> papers trying to model the probe affinities from probe sequences and
> similar. I leave it at this and for someone else to comment on it.
>
> /Henrik
>
>
>
>
>
>
>
>
>
> > Again, thank you very much for your answer and for providing this
> > discussion group that gets direct support. I find it extremely useful.
>
> > Best regards,
> > María
>
> > On Jul 10, 1:40 am, Henrik Bengtsson <henrik.bengts...@aroma-
> > project.org> wrote:
> >> Hi Maria.
>
> >> On Wed, Jul 6, 2011 at 5:59 AM, Maria Rodrigo-Domingo <mrod...@gmail.com>
> >> wrote:
> >> > Hi all,
>
> >> > I am using aroma.affymetrix for an analysis on Human Exon Array data
> >> > and would need to access the individual probe intensities mappeda to
> >> > probe_id after background correction and normalization. Is there an
> >> > easy way to do this? Below you can see what I have tried so far.
>
> >> > With the notation onhttp://www.aroma-project.org/node/37Iam looking
> >> > at object csN - data at probe-level after BC and QN
>
> >> >> affyBatch <- extractAffyBatch(csN)
> >> > # I get an error message about package "huex10stv2cdf" not being
> >> > available from Bioconductor.
>
> >> Yes, that approach, which tries to extract a "Bioconductor" AffyBatch
> >> object, is basically just a convenient wrapper around ReadAffy() of
> >> the affy package, and that is what needs a 'huex10stv2cdf' package.
>
> >> >> probes_matrix <- extractMatrix(csN, cells=NULL, field=c("intensities",
> >> >> "stdvs", "pixels"), drop=FALSE, verbose=verbose) # I do not get
> >> >> any information about which probe the intensity belongs to
>
> >> It might be that you've missed that *probes* (aka *cells* as we prefer
> >> to call them) do *not* have annotations in Affymetrix arrays. It is
> >> only *probesets* (aka *unit groups*) that have annotations.
> >> Probesets, which are defined by the CDF you choose, specifies which
> >> sets of probes should be grouped together.
>
> >> For example, if you know you are interested in probes 1040-1054, you
> >> can extra their probe intensities across all arrays in the
> >> AffymetrixCelSet ('csN') as you do:
>
> >> > cells <- 1040:1054;
> >> > Y <- extractMatrix(csN, cells=cells, field=c("intensities", "stdvs",
> >> > "pixels"), drop=FALSE, verbose=verbose);
> >> > str(Y)
>
> >> num [1:15, 1:6] 37 32 96 214 706 29 39 218 39 792 ...
> >> - attr(*, "dimnames")=List of 2
> >> ..$ : NULL
> >> ..$ : chr [1:6] "huex_wta_cerebellum_A" "huex_wta_cerebellum_B" ...
>
> >> Note how there are column names, which corresponds to the array/sample
> >> names, but there are no row names simply because probes don't have
> >> names. Probes are specified by the (x,y) coordinates on the array and
> >> there is a one-to-one mapping (x,y) <-> probe index. You can read
> >> more about this in the help of the affxparser package:
>
> >> > help("2. Cell coordinates and cell indices", package="affxparser")
> >> >> intensities <- getIntensities(csN)
> >> > # no probe or array information
>
> >> Same reason as above. (Also, I recommend to use extractMatrix()
> >> instead of getIntensities()).
>
> >> >> unitIntensities <- getUnitIntensities(csN, verbose=verbose)
> >> > # I get transcript and probeset information and the individual
> >> > intensities of the 4 probes in each probeset, but numbered 1 to 4, so
>
> >> No we're getting closer. The getUnitIntensities() returns a list
> >> structure containing probe intensities. The list structure reflects
> >> the structure of the CDF, i.e. which cells belongs to which unit
> >> groups. Note how the items in the list have names. These are the so
> >> called "unit names". Each item in turn consists of a sublist, which
> >> corresponds to the units groups. They also have names which are the
> >> so called "group names".
>
> >> > I still cannot map them to their target sequence.
>
> >> Q. So, does this mean that you are interested in finding the genomic
> >> location of each probe? Is that the kind of annotation you are
> >> looking for when you ask for "probe_id"? Note that when they designed
> >> the custom CDFs for FIRMA, they did map the 25-mer probes to the
> >> genome by their sequences, cf. subpages
> >> viahttp://aroma-project.org/chipTypes/HuEx-1_0-st-v2
>
> >> Q. Could it be that you are interested in transcript or exon
> >> summaries? See how-to page 'Extract probeset summaries (chip
> >> effects) as a data frame'
> >> [http://www.aroma-project.org/howtos/extractDataFrame] and the example
> >> for 'HuEx-1_0-st-v2' - is that what you're looking for?
>
> >> The answer will depend on what you are really after.
>
> >> /Henrik
>
> >> > I have now run out of ideas so I would really appreciate
>
> ...
>
> read more »
--
When reporting problems on aroma.affymetrix, make sure 1) to run the latest
version of the package, 2) to report the output of sessionInfo() and
traceback(), and 3) to post a complete code example.
You received this message because you are subscribed to the Google Groups
"aroma.affymetrix" group with website http://www.aroma-project.org/.
To post to this group, send email to aroma-affymetrix@googlegroups.com
To unsubscribe and other options, go to http://www.aroma-project.org/forum/
