Hello, I would like to detect the lines starting with >.+ and replace all U with T in the following line, but not in the line starting with > Example:
>NeiUe166 1551 bp rna AGAGAUUGAACAUAAGAGUUUGAUCCUGGCUCAGAUUGAACGCUGGCGGCAUGCUUU >Unc31652 1491 bp rna AGGGUUUGAUCAUGGCUCAGGACGAACGCUGGCGGUGCGCCUUAUGCAUGCAAGUCG >Unc31653 1469 bp rna AGGGUUUGAUCAUGGCUCAGAACGAACGCUGGCGGCAUGCUUCAGACAUGCAAGUCG should look like: >NeiUe166 1551 bp rna AGAGATTGAACATAAGAGTTTGATCCTGGCTCAGATTGAACGCTGGCGGCATGCTTT >Unc31652 1491 bp rna AGGGTTTGATCATGGCTCAGGACGAACGCTGGCGGTGCGCCTTATGCATGCAAGTCG >Unc31653 1469 bp rna AGGGTTTGATCATGGCTCAGAACGAACGCTGGCGGCATGCTTCAGACATGCAAGTCG The search pattern should find the >.. line but make changes only in the next line Another possibility would be to search just in the "second" line for U and replace with T It would be great if someone has an idea. Thanks a lot archaeal -- This is the BBEdit Talk public discussion group. If you have a feature request or need technical support, please email "[email protected]" rather than posting here. Follow @bbedit on Twitter: <https://twitter.com/bbedit> --- You received this message because you are subscribed to the Google Groups "BBEdit Talk" group. To unsubscribe from this group and stop receiving emails from it, send an email to [email protected]. To view this discussion on the web visit https://groups.google.com/d/msgid/bbedit/19e10d29-be79-4461-90f9-4a20d81ac63f%40googlegroups.com.
