Dear Florian, dear all, thanks for the great Gviz package.
I just recognized a problem with the calculation of the width of the plotting area for SequenceTrack. It seems that the last letter of a sequence is always missing (and sometimes also the first letter, depending on your screen size and the from/to arguments). Here is a minimal example (taken from the vignette "The Gviz User Guide" page 50): The sequence TCCT...ACA. is plotted but it should be TCCT...ACAC . If you decide to add 5' & 3' labels the first and the two last letters are removed (.CCT...AC.. instead of TCCT...ACAC). ### library(Gviz) library(BSgenome.Hsapiens.UCSC.hg19) sTrack <- SequenceTrack(Hsapiens) ## TCCT...ACA. plotTracks(sTrack, chromosome = 1, from = 20000, to = 20050) ## .CCT...AC.. plotTracks(sTrack, chromosome = 1, from = 20000, to = 20050, add53=T) Hsapiens[[1]][20000:20050] # 51-letter "DNAString" instance #seq: TCCTGGTGCTCCCACAAAGGAGAAGGGCTGATCACTCAAAGTTGCGAACAC ### The problem becomes relevant to us because we want to plot peptide sequences using the Pviz package (https://github.com/RGLab/Pviz) and we want to be sure that the complete sequences are drawn. Pviz provides a ProteinSequenceTrack class (based on SequenceTrack) that is affected by this problem, e.g. see their vignette (https://github.com/RGLab/Pviz/blob/master/vignettes/Pviz.pdf?raw=true) page 4 the first ProteinSequenceTrack example with a missing "M" on the LHS and a missing "Y" on the RHS. Kind regards, Sebastian ### My sessionInfo(): R version 3.1.0 (2014-04-10) Platform: x86_64-pc-linux-gnu (64-bit) locale: [1] LC_CTYPE=en_US.UTF-8 LC_NUMERIC=C [3] LC_TIME=en_US.UTF-8 LC_COLLATE=en_US.UTF-8 [5] LC_MONETARY=en_US.UTF-8 LC_MESSAGES=en_US.UTF-8 [7] LC_PAPER=en_US.UTF-8 LC_NAME=C [9] LC_ADDRESS=C LC_TELEPHONE=C [11] LC_MEASUREMENT=en_US.UTF-8 LC_IDENTIFICATION=C attached base packages: [1] parallel grid stats graphics grDevices utils datasets [8] methods base other attached packages: [1] BSgenome.Hsapiens.UCSC.hg19_1.3.99 BSgenome_1.32.0 [3] Biostrings_2.32.0 XVector_0.4.0 [5] GenomicRanges_1.16.3 GenomeInfoDb_1.0.2 [7] IRanges_1.22.5 Gviz_1.8.0 [9] BiocGenerics_0.10.0 devtools_1.5 [11] vimcom.plus_0.9-93 setwidth_1.0-3 [13] colorout_1.0-2 loaded via a namespace (and not attached): [1] AnnotationDbi_1.26.0 BatchJobs_1.2 [3] BBmisc_1.6 Biobase_2.24.0 [5] BiocParallel_0.6.0 biomaRt_2.20.0 [7] biovizBase_1.12.1 bitops_1.0-6 [9] brew_1.0-6 cluster_1.15.2 [11] codetools_0.2-8 colorspace_1.2-4 [13] DBI_0.2-7 dichromat_2.0-0 [15] digest_0.6.4 evaluate_0.5.5 [17] fail_1.2 foreach_1.4.2 [19] Formula_1.1-1 GenomicAlignments_1.0.1 [21] GenomicFeatures_1.16.0 Hmisc_3.14-4 [23] httr_0.3 iterators_1.0.7 [25] lattice_0.20-29 latticeExtra_0.6-26 [27] matrixStats_0.8.14 memoise_0.2.1 [29] munsell_0.4.2 plyr_1.8.1 [31] RColorBrewer_1.0-5 Rcpp_0.11.1 [33] RCurl_1.95-4.1 R.methodsS3_1.6.1 [35] Rsamtools_1.16.0 RSQLite_0.11.4 [37] rtracklayer_1.24.0 scales_0.2.4 [39] sendmailR_1.1-2 splines_3.1.0 [41] stats4_3.1.0 stringr_0.6.2 [43] survival_2.37-7 tools_3.1.0 [45] VariantAnnotation_1.10.0 whisker_0.3-2 [47] XML_3.98-1.1 zlibbioc_1.10.0 _______________________________________________ Bioc-devel@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/bioc-devel
