On 17/10/13 11:49 AM, Tan, Yifang wrote: > Right, I used the git 2.3.0. It is more like 2.3.0-devel or something like that.
> > Yifang > _________________________________________________ > National Research Council Canada > 110 Gymnasium Place, Saskatoon, SK S7N 0W9 > Conseil national de recherches Canada > Institut de biotechnologie des plantes > 110 place Gymnasium, Saskatoon (SK) S7N 0W9 > Government of Canada | Gouvernement du Canada > [email protected]; > Tel/Tél: (306) 975-5279 | Fax/Télécopieur: (306) 975-4839 > _________________________________________________ > ________________________________________ > From: Sébastien Boisvert [[email protected]] > Sent: Thursday, October 17, 2013 9:27 AM > To: Tan, Yifang > Cc: [email protected] > Subject: Re: [Denovoassembler-users] Ray compilation error > > On 17/10/13 01:36 AM, Tan, Yifang wrote: >> I am using both 2.2.0 and 2.3.0 (for a new server). >> For sure this is with 2.2.0, but it seems this was noticed with 2.3.0, too. >> Next time I will take a snapshot of the error. > > 2.3.0 is not released, surely, you are using the git version. > >> >> Thanks a lot! >> >> Yifang >> >> >> _________________________________________________ >> National Research Council Canada >> 110 Gymnasium Place, Saskatoon, SK S7N 0W9 >> Conseil national de recherches Canada >> Institut de biotechnologie des plantes >> 110 place Gymnasium, Saskatoon (SK) S7N 0W9 >> Government of Canada | Gouvernement du Canada >> [email protected]; >> Tel/Tél: (306) 975-5279 | Fax/Télécopieur: (306) 975-4839 >> _________________________________________________ >> ________________________________________ >> From: Sébastien Boisvert [[email protected]] >> Sent: Wednesday, October 16, 2013 7:13 PM >> To: Tan, Yifang >> Cc: [email protected] >> Subject: Re: [Denovoassembler-users] Ray compilation error >> >> On 16/10/13 05:24 PM, Tan, Yifang wrote: >>> Hi Sebastien: >> >> Hi, >> >> (Please use the list) >> >>> >>> Sometime I saw this message during assembly. Do you have any clue about it? >>> >>> //////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////// >>> 3 : VirtualCommunicator (service provided by VirtualCommunicator): 1356224 >>> virtual messages generated 1196883 real messages (88.2511%) >>> Error: can not add CTCCGTCGTATCTACTTTTCCAAACACTTTTGCCCTTGTTTTGGACTCTAG >>> last objects: >>> [19244] ------> ATTGGGAGTTGATACGTCTCCGTCGTATCTACTTTTCCAAACACTTTTGCC >>> [19245] ------> TTGGGAGTTGATACGTCTCCGTCGTATCTACTTTTCCAAACACTTTTGCCC >>> [19246] ------> TGGGAGTTGATACGTCTCCGTCGTATCTACTTTTCCAAACACTTTTGCCCT >>> [19247] ------> GGGAGTTGATACGTCTCCGTCGTATCTACTTTTCCAAACACTTTTGCCCTT >>> [19248] ------> GGAGTTGATACGTCTCCGTCGTATCTACTTTTCCAAACACTTTTGCCCTTG >>> [19249] ------> GAGTTGATACGTCTCCGTCGTATCTACTTTTCCAAACACTTTTGCCCTTGT >>> [19250] ------> AGTTGATACGTCTCCGTCGTATCTACTTTTCCAAACACTTTTGCCCTTGTT >>> [19251] ------> GTTGATACGTCTCCGTCGTATCTACTTTTCCAAACACTTTTGCCCTTGTTT >>> [19252] ------> TTGATACGTCTCCGTCGTATCTACTTTTCCAAACACTTTTGCCCTTGTTTT >>> [19253] ------> TGATACGTCTCCGTCGTATCTACTTTTCCAAACACTTTTGCCCTTGTTTTG >>> [19254] ------> GATACGTCTCCGTCGTATCTACTTTTCCAAACACTTTTGCCCTTGTTTTGG >>> [19255] ------> ATACGTCTCCGTCGTATCTACTTTTCCAAACACTTTTGCCCTTGTTTTGGA >>> [19256] ------> TACGTCTCCGTCGTATCTACTTTTCCAAACACTTTTGCCCTTGTTTTGGAC >>> [19257] ------> ACGTCTCCGTCGTATCTACTTTTCCAAACACTTTTGCCCTTGTTTTGGACT >>> [19258] ------> CGTCTCCGTCGTATCTACTTTTCCAAACACTTTTGCCCTTGTTTTGGACTC >>> [19259] ------> GTCTCCGTCGTATCTACTTTTCCAAACACTTTTGCCCTTGTTTTGGACTCT >> >> If I match the vertex that could not be added with the one at position >> 19259, it looks like this: >> >> [19259] ------> GTCTCCGTCGTATCTACTTTTCCAAACACTTTTGCCCTTGTTTTGGACTCT >> . ................... >> CTCCGTCGTATCTACTTTTCCAAACACTTTTGCCCTTGTTTTGGACTCTAG >> >> So this looks like a subtle bug where there is an offset of +2 instead of +1. >> >> >> Which version of Ray are you using ? >> >> >> >>> Rank 16 JoinerTaskCreator [18/18] >>> ............ >>> >>> //////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////// >>> >>> I doubt the error is due to repeat sequence (actually it is a copia-like >>> transposon). The result seem OK, but I am not sure any attention should be >>> paid. >>> >>> Thanks! >>> >>> Yifang >>> >>> _________________________________________________ >>> National Research Council Canada >>> 110 Gymnasium Place, Saskatoon, SK S7N 0W9 >>> Conseil national de recherches Canada >>> Institut de biotechnologie des plantes >>> 110 place Gymnasium, Saskatoon (SK) S7N 0W9 >>> Government of Canada | Gouvernement du Canada >>> [email protected]; >>> Tel/Tél: (306) 975-5279 | Fax/Télécopieur: (306) 975-4839 >>> _________________________________________________ >>> >> > > > ------------------------------------------------------------------------------ > October Webinars: Code for Performance > Free Intel webinars can help you accelerate application performance. > Explore tips for MPI, OpenMP, advanced profiling, and more. Get the most from > the latest Intel processors and coprocessors. See abstracts and register > > http://pubads.g.doubleclick.net/gampad/clk?id=60135031&iu=/4140/ostg.clktrk > _______________________________________________ > Denovoassembler-users mailing list > [email protected] > https://lists.sourceforge.net/lists/listinfo/denovoassembler-users > ------------------------------------------------------------------------------ October Webinars: Code for Performance Free Intel webinars can help you accelerate application performance. Explore tips for MPI, OpenMP, advanced profiling, and more. Get the most from the latest Intel processors and coprocessors. See abstracts and register > http://pubads.g.doubleclick.net/gampad/clk?id=60135031&iu=/4140/ostg.clktrk _______________________________________________ Denovoassembler-users mailing list [email protected] https://lists.sourceforge.net/lists/listinfo/denovoassembler-users
