Dear Galaxy I have a problem converting Interval to GFF.
I used the tool BED-to-GFF<http://main.g2.bx.psu.edu/tool_runner?tool_id=bed2gff1>converter. My Interval file contains 18 coulmns: *chr1 33308998 33309020 + cel-let-7-5p 0 chr1 33308999 255 22M * 0 0 AGAGGAAGAAGGAAGAAAAGAA UGAGGUAGUAGGUUGUAUAGUU XA:i:0 MD:Z:22 NM:i:0* However my GFF output only contains 9, and it has removed the feature "* cel-let-7-5p":* chr1 bed2gff region_0 33308999 33309020 0 + . region_0; Instead of region_0 I want the gene name, in this case the miRNA name. How do I do this? Best Robin
___________________________________________________________ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
