It is possible that this question has been asked/answered before. I tried searching through the galaxy-user list archives on nabble but could not find an applicable answer.
----------------------- Bowtie alignments done using a de-multiplexed Illumina sequence data set (CASAVA v.1.8.2) appear to be leading to alignment problem in our local galaxy install. At first glance this appears to be because of the " @SOMETHING<space>READINFO" read names not being handled correctly by bowtie. This is not a galaxy issue per se but what are other users doing to avoid this problem. We are using bowtie v. 0.12.7 (going to upgrade soon) at the moment. Posting a snippet from the alignment file below: MACHINE_NAME:2:1101:1533:1944 1:N:0:CGATGT 4 * 0 0 * * 0 0 NACGAAACGGGTCGGTCCGTCGGCATAGCGCGCCACGGCCTGCGGATCGG #4=DDFFFHHHFHIJHIJIHIIJJJIIIIIJJIHHFFDDDDDDDDDDDDD XM:i:0 MACHINE_NAME:2:1101:2523:1962 16 chr5 80936209 255 50M * 0 0 CTAAAAGGAAAAATTCCAGGGATTAAGGAACTTGAAGTTAGAAAAACTAN IIJJJIHHJJJIHFEIHIJIIJIJJJJIIJIIGJJIJFGHHHFEDAD=4# XA:i:1 MD:Z:49C0 NM:i:1 MACHINE_NAME:2:1101:1596:1971 16 chr13 41692461 255 50M * 0 0 GCTGAATAATAGTCCATTGTGAACATATACCATGTTTTCTTTATTTTTAN JJJJJJJJJIJJIJJJJJJJJJJJJJJHFJJJJJJJJHHHHHFFFFD=4# XA:i:1 MD:Z:49T0 NM:i:1 MACHINE_NAME:2:1101:2670:1962 1:N:0:CGATGT 4 * 0 0 * * 0 0 NTGCACTCGCCTGGATACCGTCGCCGGTGAGGTGGCATTCGAACACACCC --Hemant ___________________________________________________________ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
