Dear All, In order to figure out the Mean Inner Distance between Mate Pairs of my paired-end RNA-seq datasets, I ran Bowtie (Map with Bowtie for Illumina) with both forward and reverse datasets and mouse mm9 as reference genome. Below I list the Bowtie output for only one pair of reads (I put the fields on the left side):
For the forward read QNAME: SRR322837.8.1 FLAG: 99 RNAME: chr1 POS: 163761156 MAPQ: 255 CIAGR: 36M MRNM: = MPOS: 163761301 ISIZE: 181 SEQ: NTGGATACTATTTTGCCATAAAAAAATGAATAAAAT QUAL: %(,,')(())@@@2235885<<22222@@@###### OPT: XA:i:1 MD:Z:0A35 NM:i:1 For the reverse read QNAME: SRR322837.8.2 FLAG: 147 RNAME: chr1 POS: 163761301 MAPQ: 255 CIAGR: 36M MRNM: = MPOS: 163761156 ISIZE: -181 SEQ: TATTATGTCAATCTATGAAGAAGGACGGCGAGGTGA QUAL: GDBE@B>EEGDB=BD-=GG>GGGEDDG<GBGD8GB? OPT: MD:Z:29A6 NM:i:1 Is the ISIZE the insert size? The difference between POS and MPOS is 145bp, which is 36bp shorter than ISIZE (181). My question is: if ISIZE does mean insert size, how should I convert INSIZE into Mean Inner Distance between Mate Pairs? Thanks, Jianguang Du
___________________________________________________________ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/

