Hello Jianguang,

On the Bowtie tool form itself, please find this text:


Outputs

The output is in SAM format, and has the following columns:

  Column  Description
--------  --------------------------------------------------------
 1 QNAME  Query (pair) NAME
 2 FLAG   bitwise FLAG
 3 RNAME  Reference sequence NAME
 4 POS    1-based leftmost POSition/coordinate of clipped sequence
 5 MAPQ   MAPping Quality (Phred-scaled)
 6 CIGAR  extended CIGAR string
 7 MRNM   Mate Reference sequence NaMe ('=' if same as RNAME)
 8 MPOS   1-based Mate POSition
 9 ISIZE  Inferred insert SIZE
10 SEQ    query SEQuence on the same strand as the reference
11 QUAL   query QUALity (ASCII-33 gives the Phred base quality)
12 OPT    variable OPTional fields in the format TAG:VTYPE:VALUE


The value of ISIZE is the total insert size for this read pair.


Hopefully this helps!

Jen
Galaxy team

On 8/16/12 2:34 PM, Du, Jianguang wrote:
Dear All,

In order to figure out the Mean Inner Distance between Mate Pairs of my
paired-end RNA-seq datasets, I ran Bowtie (Map with Bowtie for Illumina)
with both forward and reverse datasets and mouse mm9 as reference
genome. Below I list the Bowtie output for only one pair of reads (I put
the fields on the left side):

For the forward read

QNAME: SRR322837.8.1

FLAG:99

RNAME:chr1

POS:163761156

MAPQ:255

CIAGR:36M

MRNM:=

MPOS:163761301

ISIZE:181

SEQ:NTGGATACTATTTTGCCATAAAAAAATGAATAAAAT

QUAL:%(,,')(())@@@2235885<<22222@@@######

OPT:XA:i:1MD:Z:0A35NM:i:1

For the reverse read

QNAME: SRR322837.8.2

FLAG:147

RNAME:chr1

POS:163761301

MAPQ:255

CIAGR:36M

MRNM:=

MPOS:163761156

ISIZE:-181

SEQ:TATTATGTCAATCTATGAAGAAGGACGGCGAGGTGA

QUAL:GDBE@B>EEGDB=BD-=GG>GGGEDDG<GBGD8GB?

OPT:MD:Z:29A6NM:i:1

Is the ISIZE the insert size? The difference between POS and MPOS is
145bp, which is 36bp shorter than ISIZE (181). My question is: if
ISIZE does mean insert size, how should I convert INSIZE into Mean Inner
Distance between Mate Pairs?

Thanks,

Jianguang Du



___________________________________________________________
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

   http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

   http://lists.bx.psu.edu/


--
Jennifer Jackson
http://galaxyproject.org
___________________________________________________________
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

 http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

 http://lists.bx.psu.edu/

Reply via email to