Hello Dominique,
Yes, this can be done. Here is the process ->
Start by splitting up the data by using the 'NGS: QC and manipulation ->
Barcode Splitter" tool. The result files will be available as links.
These can be copied and added to the "Get Data -> Upload File" tool in
the text box, in batch, and each will loaded as a dataset. Copying them
into a simple text file, then pasting into the Upload tool all at once
is a quick way to do this, or you can do one by one.
Once you have the individual files as datasets, you probably will want
to rename them to better keep track of which barcode/tag they represent.
Click on the pencil icon in the upper right corner of each dataset to do
this on the Edit Attributes form.
Next, the idea is to convert the fasta dataset to tabular, add in a
column with the "_Tag1" information, merge the original identifier
column with the new tag column, cut the columns to rearrange - (you want
just the new merged identifier and the original fasta sequence - leaving
behind the two columns with the original identifier + tag), then covert
back from tabular to fasta format. Use the tools in 'Text Manipulation'
and 'FASTA manipulation' to do these operations. I would normally
suggest creating/using a workflow at this point, but as the tags will
all be different, and the "Add column" step is in the middle of the
processing, this is probably not worth it.
Hopefully this helps!
Jen
Galaxy team
On 9/18/13 7:36 AM, D. A. Cowart wrote:
Hello,
I need to perform an action (or series of actions) on an 454 dataset
using Galaxy, and have not been able to figure out the necessary
steps, even after looking through the toolbar expressions and using
custom search.
My file is a fasta and has the standard format:
>GNJQDEZ01A940A
CTGAGTCAGGTCAACAATCATAAGATATTGGCACCATGTACCTGTGGTTCTCGTTTCC
ATGTTA
>GNJQDEZ01BJYQZ
CTGAGTCAGGTCAACAATCATAAGACATCGGCTCTCTATATTTAATATTGGT
Each of the 100,000 sequences within this file contains a specific
tag, which is the first 8 nucleotides.
There are 19 tags total. I would like to identify these tags and add
an identifier of the tag to the sequence name.
Therefore, if I am looking for the first tag (CTGAGTCA), the output
would look like:
>GNJQDEZ01A940A_*Tag1*
*CTGAGTCA*GGTCAACAATCATAAGATATTGGCACCATGTACCTGTGGTTCTCGTTTCC
ATGTTA
Is it possible to achieve this using Galaxy? If possible, could you
kindly suggest tools to use.
Thank you in advance,
Dominique Cowart
___________________________________________________________
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org. Please keep all replies on the list by
using "reply all" in your mail client. For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:
http://lists.bx.psu.edu/listinfo/galaxy-dev
To manage your subscriptions to this and other Galaxy lists,
please use the interface at:
http://lists.bx.psu.edu/
To search Galaxy mailing lists use the unified search at:
http://galaxyproject.org/search/mailinglists/
--
Jennifer Hillman-Jackson
http://galaxyproject.org
___________________________________________________________
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org. Please keep all replies on the list by
using "reply all" in your mail client. For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:
http://lists.bx.psu.edu/listinfo/galaxy-dev
To manage your subscriptions to this and other Galaxy lists,
please use the interface at:
http://lists.bx.psu.edu/
To search Galaxy mailing lists use the unified search at:
http://galaxyproject.org/search/mailinglists/
