Hello, I need to perform an action (or series of actions) on an 454 dataset using Galaxy, and have not been able to figure out the necessary steps, even after looking through the toolbar expressions and using custom search. My file is a fasta and has the standard format:
>GNJQDEZ01A940A CTGAGTCAGGTCAACAATCATAAGATATTGGCACCATGTACCTGTGGTTCTCGTTTCC ATGTTA >GNJQDEZ01BJYQZ CTGAGTCAGGTCAACAATCATAAGACATCGGCTCTCTATATTTAATATTGGT Each of the 100,000 sequences within this file contains a specific tag, which is the first 8 nucleotides. There are 19 tags total. I would like to identify these tags and add an identifier of the tag to the sequence name. Therefore, if I am looking for the first tag (CTGAGTCA), the output would look like: >GNJQDEZ01A940A_*Tag1* *CTGAGTCA*GGTCAACAATCATAAGATATTGGCACCATGTACCTGTGGTTCTCGTTTCC ATGTTA Is it possible to achieve this using Galaxy? If possible, could you kindly suggest tools to use. Thank you in advance, Dominique Cowart
___________________________________________________________ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/

