please read the faq again paying particular attention to pslCdnaFilter  
and pslReps.

can you say more about what you are doing and how many seqs of what  
type  and size and number you might have in your qry and target?

I will be back in the office on mon and can look more closely at your  
question then.

Sent from my iPhone

On Oct 30, 2009, at 7:03 AM, Xianjun Dong <[email protected]>  
wrote:

> Hi,
>
> This might be a naive question, but we have some questions to the
> parameters of BLAT.
>
> We want to get all identical (100% matched) blocks between the query  
> and
> target sequences, which means we don't want the blocks with gaps or
> mismatch inside. How can we control BLAT to output hits without gaps /
> mismatch, which means the blockSize=1, and mismatch=0?
>
> Did I explain clear here? For example, the following block is expected
> to be separated into 3 blocks (or 2 if the minScore>10, for example).
> How can I make it in BLAT, without doing a sliding window scanning?
>
> 000100 caaattagaaatttggagagtcgtcaaatgataatgctct-agcagcattagctcaagtg  
> 000159
>>>>>>> ||||||||||||||||||||||||||||||  |||||||| |||||||||||||||||||  
>>>>>>> <<<<<<
> 474529 caaattagaaatttggagagtcgtcaaatgcaaatgctctcagcagcattagctcaagtg  
> 474588
>
> 000160 gcccacctgcgataactactcaattaaagtatttaaaagctcgtcagcccaaatcctata  
> 000219
>>>>>>> ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  
>>>>>>> <<<<<<
> 474589 gcccacctgcgataactactcaattaaagtatttaaaagctcgtcagcccaaatcctata  
> 474648
>
>
> I've tried the following parameters:
> blat assembly.2bit input.fa -stepSize=5 -minIdentity=0 -minScore=0 - 
> maxGap=0
> but still, there are entries with several gap-separated blocks. It  
> seems
> that the maxGap=0 also does not work. I don't really understand why.
>
> I also tried to set maxIntron=0. This seem improve a bit, at least  
> there
> is no gap allowed in the target (which means in the output, all
> T_gap_count=0), but there is still gap/mismatch in the query. It seems
> this maxIntron is only designed for target sequence, not for the  
> query.
> blat assembly.2bit input.fa -stepSize=5 -minIdentity=0 -minScore=0
> -maxIntron=0
>
> Do you guys have any tips for this?
>
> Of course, I can always write a script to scan the axt file to parse  
> all
> 100% identical blocks.
>
> Thanks,
>
> Xianjun
>
> -- 
> ---------------------------
> Sterding (Xianjun) Dong
> PhD student, Boris Lenhard's group
> Bergen Center of Computational Science
> Bergen University, Norway
> Mobile: 0047-47361688
> Telephone: 0047-55276381
> Skype: xianjun.dong
>
> _______________________________________________
> Genome maillist  -  [email protected]
> https://lists.soe.ucsc.edu/mailman/listinfo/genome
_______________________________________________
Genome maillist  -  [email protected]
https://lists.soe.ucsc.edu/mailman/listinfo/genome

Reply via email to