Hi, Galt

I guess I am asking help at the wrong time :)

Actually, my question can be quite simple: How can I set BLAT to get 
gap-free output?

I am doing BLAT to get all identical parts(100%) with minLength>30bp in 
the query DNA sequence on target DNA sequences. The following setting 
should work by the explanation of BLAT options, but it does not.

blat assembly.2bit input.fa -stepSize=5 -minIdentity=100 -minScore=30 
-maxIntron=0

Regards,

Xianjun


Galt Barber wrote:
> please read the faq again paying particular attention to pslCdnaFilter 
> and pslReps.
>
> can you say more about what you are doing and how many seqs of what 
> type  and size and number you might have in your qry and target?
>
> I will be back in the office on mon and can look more closely at your 
> question then.
>
> Sent from my iPhone
>
> On Oct 30, 2009, at 7:03 AM, Xianjun Dong <[email protected]> 
> wrote:
>
>> Hi,
>>
>> This might be a naive question, but we have some questions to the
>> parameters of BLAT.
>>
>> We want to get all identical (100% matched) blocks between the query and
>> target sequences, which means we don't want the blocks with gaps or
>> mismatch inside. How can we control BLAT to output hits without gaps /
>> mismatch, which means the blockSize=1, and mismatch=0?
>>
>> Did I explain clear here? For example, the following block is expected
>> to be separated into 3 blocks (or 2 if the minScore>10, for example).
>> How can I make it in BLAT, without doing a sliding window scanning?
>>
>> 000100 caaattagaaatttggagagtcgtcaaatgataatgctct-agcagcattagctcaagtg 
>> 000159
>>>>>>>> ||||||||||||||||||||||||||||||  |||||||| ||||||||||||||||||| 
>>>>>>>> <<<<<<
>> 474529 caaattagaaatttggagagtcgtcaaatgcaaatgctctcagcagcattagctcaagtg 
>> 474588
>>
>> 000160 gcccacctgcgataactactcaattaaagtatttaaaagctcgtcagcccaaatcctata 
>> 000219
>>>>>>>> |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
>>>>>>>> <<<<<<
>> 474589 gcccacctgcgataactactcaattaaagtatttaaaagctcgtcagcccaaatcctata 
>> 474648
>>
>>
>> I've tried the following parameters:
>> blat assembly.2bit input.fa -stepSize=5 -minIdentity=0 -minScore=0 
>> -maxGap=0
>> but still, there are entries with several gap-separated blocks. It seems
>> that the maxGap=0 also does not work. I don't really understand why.
>>
>> I also tried to set maxIntron=0. This seem improve a bit, at least there
>> is no gap allowed in the target (which means in the output, all
>> T_gap_count=0), but there is still gap/mismatch in the query. It seems
>> this maxIntron is only designed for target sequence, not for the query.
>> blat assembly.2bit input.fa -stepSize=5 -minIdentity=0 -minScore=0
>> -maxIntron=0
>>
>> Do you guys have any tips for this?
>>
>> Of course, I can always write a script to scan the axt file to parse all
>> 100% identical blocks.
>>
>> Thanks,
>>
>> Xianjun
>>
>> -- 
>> ---------------------------
>> Sterding (Xianjun) Dong
>> PhD student, Boris Lenhard's group
>> Bergen Center of Computational Science
>> Bergen University, Norway
>> Mobile: 0047-47361688
>> Telephone: 0047-55276381
>> Skype: xianjun.dong
>>
>> _______________________________________________
>> Genome maillist  -  [email protected]
>> https://lists.soe.ucsc.edu/mailman/listinfo/genome

-- 
---------------------------
Sterding (Xianjun) Dong
PhD student, Boris Lenhard's group
Bergen Center of Computational Science
Bergen University, Norway
Mobile: 0047-47361688
Telephone: 0047-55276381
Skype: xianjun.dong

_______________________________________________
Genome maillist  -  [email protected]
https://lists.soe.ucsc.edu/mailman/listinfo/genome

Reply via email to