Hi, Galt I guess I am asking help at the wrong time :)
Actually, my question can be quite simple: How can I set BLAT to get gap-free output? I am doing BLAT to get all identical parts(100%) with minLength>30bp in the query DNA sequence on target DNA sequences. The following setting should work by the explanation of BLAT options, but it does not. blat assembly.2bit input.fa -stepSize=5 -minIdentity=100 -minScore=30 -maxIntron=0 Regards, Xianjun Galt Barber wrote: > please read the faq again paying particular attention to pslCdnaFilter > and pslReps. > > can you say more about what you are doing and how many seqs of what > type and size and number you might have in your qry and target? > > I will be back in the office on mon and can look more closely at your > question then. > > Sent from my iPhone > > On Oct 30, 2009, at 7:03 AM, Xianjun Dong <[email protected]> > wrote: > >> Hi, >> >> This might be a naive question, but we have some questions to the >> parameters of BLAT. >> >> We want to get all identical (100% matched) blocks between the query and >> target sequences, which means we don't want the blocks with gaps or >> mismatch inside. How can we control BLAT to output hits without gaps / >> mismatch, which means the blockSize=1, and mismatch=0? >> >> Did I explain clear here? For example, the following block is expected >> to be separated into 3 blocks (or 2 if the minScore>10, for example). >> How can I make it in BLAT, without doing a sliding window scanning? >> >> 000100 caaattagaaatttggagagtcgtcaaatgataatgctct-agcagcattagctcaagtg >> 000159 >>>>>>>> |||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||| >>>>>>>> <<<<<< >> 474529 caaattagaaatttggagagtcgtcaaatgcaaatgctctcagcagcattagctcaagtg >> 474588 >> >> 000160 gcccacctgcgataactactcaattaaagtatttaaaagctcgtcagcccaaatcctata >> 000219 >>>>>>>> |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| >>>>>>>> <<<<<< >> 474589 gcccacctgcgataactactcaattaaagtatttaaaagctcgtcagcccaaatcctata >> 474648 >> >> >> I've tried the following parameters: >> blat assembly.2bit input.fa -stepSize=5 -minIdentity=0 -minScore=0 >> -maxGap=0 >> but still, there are entries with several gap-separated blocks. It seems >> that the maxGap=0 also does not work. I don't really understand why. >> >> I also tried to set maxIntron=0. This seem improve a bit, at least there >> is no gap allowed in the target (which means in the output, all >> T_gap_count=0), but there is still gap/mismatch in the query. It seems >> this maxIntron is only designed for target sequence, not for the query. >> blat assembly.2bit input.fa -stepSize=5 -minIdentity=0 -minScore=0 >> -maxIntron=0 >> >> Do you guys have any tips for this? >> >> Of course, I can always write a script to scan the axt file to parse all >> 100% identical blocks. >> >> Thanks, >> >> Xianjun >> >> -- >> --------------------------- >> Sterding (Xianjun) Dong >> PhD student, Boris Lenhard's group >> Bergen Center of Computational Science >> Bergen University, Norway >> Mobile: 0047-47361688 >> Telephone: 0047-55276381 >> Skype: xianjun.dong >> >> _______________________________________________ >> Genome maillist - [email protected] >> https://lists.soe.ucsc.edu/mailman/listinfo/genome -- --------------------------- Sterding (Xianjun) Dong PhD student, Boris Lenhard's group Bergen Center of Computational Science Bergen University, Norway Mobile: 0047-47361688 Telephone: 0047-55276381 Skype: xianjun.dong _______________________________________________ Genome maillist - [email protected] https://lists.soe.ucsc.edu/mailman/listinfo/genome
