I am working with Xianjun offline.
If anything useful presents itself, I'll add a note to this thread.
-Galt

Xianjun Dong wrote:
> Hi, Galt
> 
> I guess I am asking help at the wrong time :)
> 
> Actually, my question can be quite simple: How can I set BLAT to get 
> gap-free output?
> 
> I am doing BLAT to get all identical parts(100%) with minLength>30bp in 
> the query DNA sequence on target DNA sequences. The following setting 
> should work by the explanation of BLAT options, but it does not.
> 
> blat assembly.2bit input.fa -stepSize=5 -minIdentity=100 -minScore=30 
> -maxIntron=0
> 
> Regards,
> 
> Xianjun
> 
> 
> Galt Barber wrote:
>> please read the faq again paying particular attention to pslCdnaFilter 
>> and pslReps.
>>
>> can you say more about what you are doing and how many seqs of what 
>> type  and size and number you might have in your qry and target?
>>
>> I will be back in the office on mon and can look more closely at your 
>> question then.
>>
>> Sent from my iPhone
>>
>> On Oct 30, 2009, at 7:03 AM, Xianjun Dong <[email protected]> 
>> wrote:
>>
>>> Hi,
>>>
>>> This might be a naive question, but we have some questions to the
>>> parameters of BLAT.
>>>
>>> We want to get all identical (100% matched) blocks between the query and
>>> target sequences, which means we don't want the blocks with gaps or
>>> mismatch inside. How can we control BLAT to output hits without gaps /
>>> mismatch, which means the blockSize=1, and mismatch=0?
>>>
>>> Did I explain clear here? For example, the following block is expected
>>> to be separated into 3 blocks (or 2 if the minScore>10, for example).
>>> How can I make it in BLAT, without doing a sliding window scanning?
>>>
>>> 000100 caaattagaaatttggagagtcgtcaaatgataatgctct-agcagcattagctcaagtg 
>>> 000159
>>>>>>>>> ||||||||||||||||||||||||||||||  |||||||| ||||||||||||||||||| 
>>>>>>>>> <<<<<<
>>> 474529 caaattagaaatttggagagtcgtcaaatgcaaatgctctcagcagcattagctcaagtg 
>>> 474588
>>>
>>> 000160 gcccacctgcgataactactcaattaaagtatttaaaagctcgtcagcccaaatcctata 
>>> 000219
>>>>>>>>> |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
>>>>>>>>> <<<<<<
>>> 474589 gcccacctgcgataactactcaattaaagtatttaaaagctcgtcagcccaaatcctata 
>>> 474648
>>>
>>>
>>> I've tried the following parameters:
>>> blat assembly.2bit input.fa -stepSize=5 -minIdentity=0 -minScore=0 
>>> -maxGap=0
>>> but still, there are entries with several gap-separated blocks. It seems
>>> that the maxGap=0 also does not work. I don't really understand why.
>>>
>>> I also tried to set maxIntron=0. This seem improve a bit, at least there
>>> is no gap allowed in the target (which means in the output, all
>>> T_gap_count=0), but there is still gap/mismatch in the query. It seems
>>> this maxIntron is only designed for target sequence, not for the query.
>>> blat assembly.2bit input.fa -stepSize=5 -minIdentity=0 -minScore=0
>>> -maxIntron=0
>>>
>>> Do you guys have any tips for this?
>>>
>>> Of course, I can always write a script to scan the axt file to parse all
>>> 100% identical blocks.
>>>
>>> Thanks,
>>>
>>> Xianjun
>>>
>>> -- 
>>> ---------------------------
>>> Sterding (Xianjun) Dong
>>> PhD student, Boris Lenhard's group
>>> Bergen Center of Computational Science
>>> Bergen University, Norway
>>> Mobile: 0047-47361688
>>> Telephone: 0047-55276381
>>> Skype: xianjun.dong
>>>
>>> _______________________________________________
>>> Genome maillist  -  [email protected]
>>> https://lists.soe.ucsc.edu/mailman/listinfo/genome
> 
_______________________________________________
Genome maillist  -  [email protected]
https://lists.soe.ucsc.edu/mailman/listinfo/genome

Reply via email to