Do you mean like this:

$ nibFrag -masked chrM.nib 2500 2800 + stdout
 >chrM.nib:2500-2800
TACCAAAAACATCACCTCTAGCATCACCAGTATTAGAGGCACCGCCTGCC
CAGTGACACATGTTTAACGGCCGCGGTACCCTAACCGTGCAaaggtagca
taatcacttgttccttaaatagggacctgtatgaatggctccacgagggt
tcagctgtctcttacttttaaccagtgaaattgacctgcccgtgaagagg
cgggcatgacacagcaagacgagaagaccctatggagctttaatttaTTA
ATGCAAACAGTACCTAACAAACCCACAGGTCCTAAACTACCAAACCTGCA

Note the lower case letters, that is the masked sequence.

--Hiram

Shah, Jyoti K. wrote:
> Hi Hiram,
> 
> Yes. I thought that 'masked' option would invoke 'repeat masking' on the
> sequence (extracted using nibFrag) and looks like that is not the case.
> Am I right? 
> 
> Thanks
> Jyoti
> 
> -----Original Message-----
> From: Hiram Clawson [mailto:[email protected]] 
> Sent: Monday, January 12, 2009 11:21 PM
> To: Shah, Jyoti K.
> Cc: [email protected]
> Subject: Re: [Genome] nibFrag
> 
> Good Evenin Jyoti:
> 
> I guess it depends upon where you obtained the nib files from ?
> What nib files are you using and how do you operate the command ?
> The option -masked does the following:
>       -masked - use lower case characters for bases meant to be masked
> out
> which means it prints lower case characters in masked regions.
> 
> What do you mean "not able to repeat mask sequence" ?
> Are you trying to run RepeatMasker ?
> 
> --Hiram
> 
> Shah, Jyoti K. wrote:
>> Hi UCSC team,
>>
>> I am using your nibFrag tool to extract parts of a sequence. I am not
>> able to repeat mask sequences using you 'masked' or 'hardMasked'
>> options. Do they really mask the sequence or they just ignore the
> parts
>> of sequence that have been pre-masked?
>>
>> Thanks
>> Jyoti
> Notice:  This e-mail message, together with any attachments, contains
> information of Merck & Co., Inc. (One Merck Drive, Whitehouse Station,
> New Jersey, USA 08889), and/or its affiliates (which may be known
> outside the United States as Merck Frosst, Merck Sharp & Dohme or
> MSD and in Japan, as Banyu - direct contact information for affiliates is
> available at http://www.merck.com/contact/contacts.html) that may be
> confidential, proprietary copyrighted and/or legally privileged. It is
> intended solely for the use of the individual or entity named on this
> message. If you are not the intended recipient, and have received this
> message in error, please notify us immediately by reply e-mail and
> then delete it from your system.
> 
> 
_______________________________________________
Genome maillist  -  [email protected]
http://www.soe.ucsc.edu/mailman/listinfo/genome

Reply via email to