Do you mean like this: $ nibFrag -masked chrM.nib 2500 2800 + stdout >chrM.nib:2500-2800 TACCAAAAACATCACCTCTAGCATCACCAGTATTAGAGGCACCGCCTGCC CAGTGACACATGTTTAACGGCCGCGGTACCCTAACCGTGCAaaggtagca taatcacttgttccttaaatagggacctgtatgaatggctccacgagggt tcagctgtctcttacttttaaccagtgaaattgacctgcccgtgaagagg cgggcatgacacagcaagacgagaagaccctatggagctttaatttaTTA ATGCAAACAGTACCTAACAAACCCACAGGTCCTAAACTACCAAACCTGCA
Note the lower case letters, that is the masked sequence. --Hiram Shah, Jyoti K. wrote: > Hi Hiram, > > Yes. I thought that 'masked' option would invoke 'repeat masking' on the > sequence (extracted using nibFrag) and looks like that is not the case. > Am I right? > > Thanks > Jyoti > > -----Original Message----- > From: Hiram Clawson [mailto:[email protected]] > Sent: Monday, January 12, 2009 11:21 PM > To: Shah, Jyoti K. > Cc: [email protected] > Subject: Re: [Genome] nibFrag > > Good Evenin Jyoti: > > I guess it depends upon where you obtained the nib files from ? > What nib files are you using and how do you operate the command ? > The option -masked does the following: > -masked - use lower case characters for bases meant to be masked > out > which means it prints lower case characters in masked regions. > > What do you mean "not able to repeat mask sequence" ? > Are you trying to run RepeatMasker ? > > --Hiram > > Shah, Jyoti K. wrote: >> Hi UCSC team, >> >> I am using your nibFrag tool to extract parts of a sequence. I am not >> able to repeat mask sequences using you 'masked' or 'hardMasked' >> options. Do they really mask the sequence or they just ignore the > parts >> of sequence that have been pre-masked? >> >> Thanks >> Jyoti > Notice: This e-mail message, together with any attachments, contains > information of Merck & Co., Inc. (One Merck Drive, Whitehouse Station, > New Jersey, USA 08889), and/or its affiliates (which may be known > outside the United States as Merck Frosst, Merck Sharp & Dohme or > MSD and in Japan, as Banyu - direct contact information for affiliates is > available at http://www.merck.com/contact/contacts.html) that may be > confidential, proprietary copyrighted and/or legally privileged. It is > intended solely for the use of the individual or entity named on this > message. If you are not the intended recipient, and have received this > message in error, please notify us immediately by reply e-mail and > then delete it from your system. > > _______________________________________________ Genome maillist - [email protected] http://www.soe.ucsc.edu/mailman/listinfo/genome
