It is not working for me. $nibFrag -masked chrM.nib 2500 2800 + stdout >chrMnib_2500_2800 >chrM.nib:2500-2800 TACCAAAAACATCACCTCTAGCATCACCAGTATTAGAGGCACCGCCTGCC CAGTGACACATGTTTAACGGCCGCGGTACCCTAACCGTGCAAAGGTAGCA TAATCACTTGTTCCTTAAATAGGGACCTGTATGAATGGCTCCACGAGGGT TCAGCTGTCTCTTACTTTTAACCAGTGAAATTGACCTGCCCGTGAAGAGG CGGGCATGACACAGCAAGACGAGAAGACCCTATGGAGCTTTAATTTATTA ATGCAAACAGTACCTAACAAACCCACAGGTCCTAAACTACCAAACCTGCA
Do you know what could be causing this? Older version? Etc. -----Original Message----- From: Hiram Clawson [mailto:[email protected]] Sent: Tuesday, January 13, 2009 10:33 AM To: Shah, Jyoti K. Cc: [email protected] Subject: Re: [Genome] nibFrag Do you mean like this: $ nibFrag -masked chrM.nib 2500 2800 + stdout >chrM.nib:2500-2800 TACCAAAAACATCACCTCTAGCATCACCAGTATTAGAGGCACCGCCTGCC CAGTGACACATGTTTAACGGCCGCGGTACCCTAACCGTGCAaaggtagca taatcacttgttccttaaatagggacctgtatgaatggctccacgagggt tcagctgtctcttacttttaaccagtgaaattgacctgcccgtgaagagg cgggcatgacacagcaagacgagaagaccctatggagctttaatttaTTA ATGCAAACAGTACCTAACAAACCCACAGGTCCTAAACTACCAAACCTGCA Note the lower case letters, that is the masked sequence. --Hiram Shah, Jyoti K. wrote: > Hi Hiram, > > Yes. I thought that 'masked' option would invoke 'repeat masking' on the > sequence (extracted using nibFrag) and looks like that is not the case. > Am I right? > > Thanks > Jyoti > > -----Original Message----- > From: Hiram Clawson [mailto:[email protected]] > Sent: Monday, January 12, 2009 11:21 PM > To: Shah, Jyoti K. > Cc: [email protected] > Subject: Re: [Genome] nibFrag > > Good Evenin Jyoti: > > I guess it depends upon where you obtained the nib files from ? > What nib files are you using and how do you operate the command ? > The option -masked does the following: > -masked - use lower case characters for bases meant to be masked > out > which means it prints lower case characters in masked regions. > > What do you mean "not able to repeat mask sequence" ? > Are you trying to run RepeatMasker ? > > --Hiram > > Shah, Jyoti K. wrote: >> Hi UCSC team, >> >> I am using your nibFrag tool to extract parts of a sequence. I am not >> able to repeat mask sequences using you 'masked' or 'hardMasked' >> options. Do they really mask the sequence or they just ignore the > parts >> of sequence that have been pre-masked? >> >> Thanks >> Jyoti > Notice: This e-mail message, together with any attachments, contains > information of Merck & Co., Inc. (One Merck Drive, Whitehouse Station, > New Jersey, USA 08889), and/or its affiliates (which may be known > outside the United States as Merck Frosst, Merck Sharp & Dohme or > MSD and in Japan, as Banyu - direct contact information for affiliates is > available at http://www.merck.com/contact/contacts.html) that may be > confidential, proprietary copyrighted and/or legally privileged. It is > intended solely for the use of the individual or entity named on this > message. If you are not the intended recipient, and have received this > message in error, please notify us immediately by reply e-mail and > then delete it from your system. > > Notice: This e-mail message, together with any attachments, contains information of Merck & Co., Inc. (One Merck Drive, Whitehouse Station, New Jersey, USA 08889), and/or its affiliates (which may be known outside the United States as Merck Frosst, Merck Sharp & Dohme or MSD and in Japan, as Banyu - direct contact information for affiliates is available at http://www.merck.com/contact/contacts.html) that may be confidential, proprietary copyrighted and/or legally privileged. It is intended solely for the use of the individual or entity named on this message. If you are not the intended recipient, and have received this message in error, please notify us immediately by reply e-mail and then delete it from your system. _______________________________________________ Genome maillist - [email protected] http://www.soe.ucsc.edu/mailman/listinfo/genome
