Where do you obtain your .nib files from ? $ ls -og chrM.nib -rw-rw-r-- 1 8294 Dec 9 2005 chrM.nib $ sum chrM.nib 24124 9
Shah, Jyoti K. wrote: > It is not working for me. > > $nibFrag -masked chrM.nib 2500 2800 + stdout >chrMnib_2500_2800 >> chrM.nib:2500-2800 > TACCAAAAACATCACCTCTAGCATCACCAGTATTAGAGGCACCGCCTGCC > CAGTGACACATGTTTAACGGCCGCGGTACCCTAACCGTGCAAAGGTAGCA > TAATCACTTGTTCCTTAAATAGGGACCTGTATGAATGGCTCCACGAGGGT > TCAGCTGTCTCTTACTTTTAACCAGTGAAATTGACCTGCCCGTGAAGAGG > CGGGCATGACACAGCAAGACGAGAAGACCCTATGGAGCTTTAATTTATTA > ATGCAAACAGTACCTAACAAACCCACAGGTCCTAAACTACCAAACCTGCA > > Do you know what could be causing this? Older version? Etc. > > -----Original Message----- > From: Hiram Clawson [mailto:[email protected]] > Sent: Tuesday, January 13, 2009 10:33 AM > To: Shah, Jyoti K. > Cc: [email protected] > Subject: Re: [Genome] nibFrag > > Do you mean like this: > > $ nibFrag -masked chrM.nib 2500 2800 + stdout > >chrM.nib:2500-2800 > TACCAAAAACATCACCTCTAGCATCACCAGTATTAGAGGCACCGCCTGCC > CAGTGACACATGTTTAACGGCCGCGGTACCCTAACCGTGCAaaggtagca > taatcacttgttccttaaatagggacctgtatgaatggctccacgagggt > tcagctgtctcttacttttaaccagtgaaattgacctgcccgtgaagagg > cgggcatgacacagcaagacgagaagaccctatggagctttaatttaTTA > ATGCAAACAGTACCTAACAAACCCACAGGTCCTAAACTACCAAACCTGCA > > Note the lower case letters, that is the masked sequence. > > --Hiram > > Shah, Jyoti K. wrote: >> Hi Hiram, >> >> Yes. I thought that 'masked' option would invoke 'repeat masking' on > the >> sequence (extracted using nibFrag) and looks like that is not the > case. >> Am I right? >> >> Thanks >> Jyoti >> >> -----Original Message----- >> From: Hiram Clawson [mailto:[email protected]] >> Sent: Monday, January 12, 2009 11:21 PM >> To: Shah, Jyoti K. >> Cc: [email protected] >> Subject: Re: [Genome] nibFrag >> >> Good Evenin Jyoti: >> >> I guess it depends upon where you obtained the nib files from ? >> What nib files are you using and how do you operate the command ? >> The option -masked does the following: >> -masked - use lower case characters for bases meant to be masked >> out >> which means it prints lower case characters in masked regions. >> >> What do you mean "not able to repeat mask sequence" ? >> Are you trying to run RepeatMasker ? >> >> --Hiram >> >> Shah, Jyoti K. wrote: >>> Hi UCSC team, >>> >>> I am using your nibFrag tool to extract parts of a sequence. I am not >>> able to repeat mask sequences using you 'masked' or 'hardMasked' >>> options. Do they really mask the sequence or they just ignore the >> parts >>> of sequence that have been pre-masked? >>> >>> Thanks >>> Jyoti >> Notice: This e-mail message, together with any attachments, contains >> information of Merck & Co., Inc. (One Merck Drive, Whitehouse Station, >> New Jersey, USA 08889), and/or its affiliates (which may be known >> outside the United States as Merck Frosst, Merck Sharp & Dohme or >> MSD and in Japan, as Banyu - direct contact information for affiliates > is >> available at http://www.merck.com/contact/contacts.html) that may be >> confidential, proprietary copyrighted and/or legally privileged. It is >> intended solely for the use of the individual or entity named on this >> message. If you are not the intended recipient, and have received this >> message in error, please notify us immediately by reply e-mail and >> then delete it from your system. >> >> > Notice: This e-mail message, together with any attachments, contains > information of Merck & Co., Inc. (One Merck Drive, Whitehouse Station, > New Jersey, USA 08889), and/or its affiliates (which may be known > outside the United States as Merck Frosst, Merck Sharp & Dohme or > MSD and in Japan, as Banyu - direct contact information for affiliates is > available at http://www.merck.com/contact/contacts.html) that may be > confidential, proprietary copyrighted and/or legally privileged. It is > intended solely for the use of the individual or entity named on this > message. If you are not the intended recipient, and have received this > message in error, please notify us immediately by reply e-mail and > then delete it from your system. > > _______________________________________________ Genome maillist - [email protected] http://www.soe.ucsc.edu/mailman/listinfo/genome
