Where do you obtain your .nib files from ?

$ ls -og chrM.nib
-rw-rw-r--  1 8294 Dec  9  2005 chrM.nib
$ sum chrM.nib
24124     9


Shah, Jyoti K. wrote:
> It is not working for me.
> 
> $nibFrag -masked chrM.nib  2500 2800 + stdout >chrMnib_2500_2800 
>> chrM.nib:2500-2800
> TACCAAAAACATCACCTCTAGCATCACCAGTATTAGAGGCACCGCCTGCC
> CAGTGACACATGTTTAACGGCCGCGGTACCCTAACCGTGCAAAGGTAGCA
> TAATCACTTGTTCCTTAAATAGGGACCTGTATGAATGGCTCCACGAGGGT
> TCAGCTGTCTCTTACTTTTAACCAGTGAAATTGACCTGCCCGTGAAGAGG
> CGGGCATGACACAGCAAGACGAGAAGACCCTATGGAGCTTTAATTTATTA
> ATGCAAACAGTACCTAACAAACCCACAGGTCCTAAACTACCAAACCTGCA
> 
> Do you know what could be causing this? Older version? Etc.
> 
> -----Original Message-----
> From: Hiram Clawson [mailto:[email protected]] 
> Sent: Tuesday, January 13, 2009 10:33 AM
> To: Shah, Jyoti K.
> Cc: [email protected]
> Subject: Re: [Genome] nibFrag
> 
> Do you mean like this:
> 
> $ nibFrag -masked chrM.nib 2500 2800 + stdout
>  >chrM.nib:2500-2800
> TACCAAAAACATCACCTCTAGCATCACCAGTATTAGAGGCACCGCCTGCC
> CAGTGACACATGTTTAACGGCCGCGGTACCCTAACCGTGCAaaggtagca
> taatcacttgttccttaaatagggacctgtatgaatggctccacgagggt
> tcagctgtctcttacttttaaccagtgaaattgacctgcccgtgaagagg
> cgggcatgacacagcaagacgagaagaccctatggagctttaatttaTTA
> ATGCAAACAGTACCTAACAAACCCACAGGTCCTAAACTACCAAACCTGCA
> 
> Note the lower case letters, that is the masked sequence.
> 
> --Hiram
> 
> Shah, Jyoti K. wrote:
>> Hi Hiram,
>>
>> Yes. I thought that 'masked' option would invoke 'repeat masking' on
> the
>> sequence (extracted using nibFrag) and looks like that is not the
> case.
>> Am I right? 
>>
>> Thanks
>> Jyoti
>>
>> -----Original Message-----
>> From: Hiram Clawson [mailto:[email protected]] 
>> Sent: Monday, January 12, 2009 11:21 PM
>> To: Shah, Jyoti K.
>> Cc: [email protected]
>> Subject: Re: [Genome] nibFrag
>>
>> Good Evenin Jyoti:
>>
>> I guess it depends upon where you obtained the nib files from ?
>> What nib files are you using and how do you operate the command ?
>> The option -masked does the following:
>>      -masked - use lower case characters for bases meant to be masked
>> out
>> which means it prints lower case characters in masked regions.
>>
>> What do you mean "not able to repeat mask sequence" ?
>> Are you trying to run RepeatMasker ?
>>
>> --Hiram
>>
>> Shah, Jyoti K. wrote:
>>> Hi UCSC team,
>>>
>>> I am using your nibFrag tool to extract parts of a sequence. I am not
>>> able to repeat mask sequences using you 'masked' or 'hardMasked'
>>> options. Do they really mask the sequence or they just ignore the
>> parts
>>> of sequence that have been pre-masked?
>>>
>>> Thanks
>>> Jyoti
>> Notice:  This e-mail message, together with any attachments, contains
>> information of Merck & Co., Inc. (One Merck Drive, Whitehouse Station,
>> New Jersey, USA 08889), and/or its affiliates (which may be known
>> outside the United States as Merck Frosst, Merck Sharp & Dohme or
>> MSD and in Japan, as Banyu - direct contact information for affiliates
> is
>> available at http://www.merck.com/contact/contacts.html) that may be
>> confidential, proprietary copyrighted and/or legally privileged. It is
>> intended solely for the use of the individual or entity named on this
>> message. If you are not the intended recipient, and have received this
>> message in error, please notify us immediately by reply e-mail and
>> then delete it from your system.
>>
>>
> Notice:  This e-mail message, together with any attachments, contains
> information of Merck & Co., Inc. (One Merck Drive, Whitehouse Station,
> New Jersey, USA 08889), and/or its affiliates (which may be known
> outside the United States as Merck Frosst, Merck Sharp & Dohme or
> MSD and in Japan, as Banyu - direct contact information for affiliates is
> available at http://www.merck.com/contact/contacts.html) that may be
> confidential, proprietary copyrighted and/or legally privileged. It is
> intended solely for the use of the individual or entity named on this
> message. If you are not the intended recipient, and have received this
> message in error, please notify us immediately by reply e-mail and
> then delete it from your system.
> 
> 

_______________________________________________
Genome maillist  -  [email protected]
http://www.soe.ucsc.edu/mailman/listinfo/genome

Reply via email to