Hi, I have a couple of files containing several Dog genomic coordinates that I want to lift over to the Human genome. I have down loaded the canFam2ToHg19.over.chain files from UCSC website and using it with previously installed UCSC "liftOver" program to do this.
For a test, I used just two Dog genome coordinates, as listed below (in file) chr20 58241270 58241311 contig_1 42 + chr6 54123651 54123725 contig_2 75 + When I use the liftOver program with canFam2ToHg19.over.chain, I get one mapped to Human genome and second one goes to unmapped output. For example, This one gets mapped to Human genome (out file 1) chr1 99175258 99175341 contig_2 1 - And the other one remains unmapped (out file 2) #Partially deleted in new chr20 58241270 58241311 contig_1 42 + When I tested this by using their original sequences the both Dog contigs actually show corresponding interonic regions of Human genome. First one mapping to SH3GL2 gene and second to SNX7 gene (this is correctly identified by liftOver program). I do not also understand what "#Partially deleted in new" means? Why is it not able to lift over the coordinates of the first contig? Here are the two sequences used; >contig_1 GGCCAGCTCCTGAGTCTGCTGCCCTCTTAGAGCGTAGCCACA >contig_2 GGCAGGTCTGGATCTGAATTGAAGCTCTTAATAGCCTAGGAACTAATGTAAAAAGTGGGATGGGATCAGGTATAA I will appreciate any help. Thanks, perdeep Perdeep K. Mehta, PhD Research Scientist, Bioinformatics Research Informatics, Information Sciences Division St. Jude Children's Research Hospital ________________________________ Email Disclaimer: www.stjude.org/emaildisclaimer _______________________________________________ Genome maillist - [email protected] https://lists.soe.ucsc.edu/mailman/listinfo/genome
