Hi,

I have a couple of files containing several Dog genomic coordinates that I want 
to lift over to the Human genome. I have down loaded the 
canFam2ToHg19.over.chain files from UCSC website and using it with previously 
installed UCSC "liftOver" program to do this.

For a test, I used just two Dog genome coordinates, as listed below (in file)
chr20   58241270        58241311        contig_1        42      +
chr6    54123651        54123725        contig_2        75      +

When I use the liftOver program with canFam2ToHg19.over.chain, I get one mapped 
to Human genome and second one goes to unmapped output. For example,
This one gets mapped to Human genome (out file 1)
chr1    99175258        99175341        contig_2        1       -

And the other one remains unmapped (out file 2)
#Partially deleted in new
chr20   58241270        58241311        contig_1        42      +

When I tested this by using their original sequences the both Dog contigs 
actually show corresponding interonic regions of Human genome. First one 
mapping to SH3GL2 gene and second to SNX7 gene (this is correctly identified by 
liftOver program).

I do not also understand what "#Partially deleted in new" means?  Why is it not 
able to lift over the coordinates of the first contig?

Here are the two sequences used;
>contig_1
GGCCAGCTCCTGAGTCTGCTGCCCTCTTAGAGCGTAGCCACA
>contig_2
GGCAGGTCTGGATCTGAATTGAAGCTCTTAATAGCCTAGGAACTAATGTAAAAAGTGGGATGGGATCAGGTATAA

I will appreciate any help.

Thanks,
perdeep

Perdeep K. Mehta, PhD
Research Scientist, Bioinformatics
Research Informatics, Information Sciences Division
St. Jude Children's Research Hospital



  ________________________________
Email Disclaimer: www.stjude.org/emaildisclaimer
_______________________________________________
Genome maillist  -  [email protected]
https://lists.soe.ucsc.edu/mailman/listinfo/genome

Reply via email to