Hi Perdeep,

Yes, setting minMatch to 01 (100%) would definitely be an issue.

- Greg


On 4/15/11 7:05 AM, Mehta, Perdeep wrote:
> Hi Greg,
>
> Thank you for your response. By looking at your suggestion, I think I have 
> found the reason though I have not tested it yet. I had already used the 
> -minMatch switch, but for some reason instead of 0.1 it was set to 01. I had 
> a typo in the file where this command was stored for later use and I had 
> copy/paste it. I apologize also for not explicitly writing the full command 
> that I had used.
>
> I will test it soon and if there are still any problem with let you know.
>
> Thanks again for helping with this.
> perdeep
>
> Perdeep K. Mehta, PhD
> Research Informatics, Information Sciences Division
> St. Jude Children's Research Hospital
> 262 Danny Thomas Place
> Memphis, TN 38105
>
> -----Original Message-----
> From: Greg Roe [mailto:[email protected]]
> Sent: Monday, April 11, 2011 4:17 PM
> To: Mehta, Perdeep
> Cc: '[email protected]'
> Subject: Re: [Genome] lifting over Dog genomic coordinates to Human genome
>
> Hi Perdeep,
>
> Sorry for the delayed reply.
>
> "Partially deleted in new" means that the sequence intersects with only
> part of a single alignment chain in the region.  I suspect you have the
> "Minimum ratio of bases that must remap/Minmatch" setting too high.  The
> online version of liftOver defaults minmatch to .95 for within species
> liftovers and 0.1 for liftOvers between different species. The command
> line liftOver application always defaults to 0.95.  Thus you may get
> different results between the two if you don't make sure nimMatch is set
> the same.
>
> Try running the liftOver again at the command line and setting -minMatch=0.1
>
> You can see all liftOver options at the command line by just typing
> "liftOver".
>
> Let us know if you have any additional questions: [email protected]
>
> -
> Greg Roe
> UCSC Genome Bioinformatics Group
>
>
> On 4/4/11 2:58 PM, Mehta, Perdeep wrote:
>> Hi,
>>
>> I have a couple of files containing several Dog genomic coordinates that I 
>> want to lift over to the Human genome. I have down loaded the 
>> canFam2ToHg19.over.chain files from UCSC website and using it with 
>> previously installed UCSC "liftOver" program to do this.
>>
>> For a test, I used just two Dog genome coordinates, as listed below (in file)
>> chr20   58241270        58241311        contig_1        42      +
>> chr6    54123651        54123725        contig_2        75      +
>>
>> When I use the liftOver program with canFam2ToHg19.over.chain, I get one 
>> mapped to Human genome and second one goes to unmapped output. For example,
>> This one gets mapped to Human genome (out file 1)
>> chr1    99175258        99175341        contig_2        1       -
>>
>> And the other one remains unmapped (out file 2)
>> #Partially deleted in new
>> chr20   58241270        58241311        contig_1        42      +
>>
>> When I tested this by using their original sequences the both Dog contigs 
>> actually show corresponding interonic regions of Human genome. First one 
>> mapping to SH3GL2 gene and second to SNX7 gene (this is correctly identified 
>> by liftOver program).
>>
>> I do not also understand what "#Partially deleted in new" means?  Why is it 
>> not able to lift over the coordinates of the first contig?
>>
>> Here are the two sequences used;
>>> contig_1
>> GGCCAGCTCCTGAGTCTGCTGCCCTCTTAGAGCGTAGCCACA
>>> contig_2
>> GGCAGGTCTGGATCTGAATTGAAGCTCTTAATAGCCTAGGAACTAATGTAAAAAGTGGGATGGGATCAGGTATAA
>>
>> I will appreciate any help.
>>
>> Thanks,
>> perdeep
>>
>> Perdeep K. Mehta, PhD
>> Research Scientist, Bioinformatics
>> Research Informatics, Information Sciences Division
>> St. Jude Children's Research Hospital
>>
>>
>>
>>     ________________________________
>> Email Disclaimer: www.stjude.org/emaildisclaimer
>> _______________________________________________
>> Genome maillist  -  [email protected]
>> https://lists.soe.ucsc.edu/mailman/listinfo/genome
>
_______________________________________________
Genome maillist  -  [email protected]
https://lists.soe.ucsc.edu/mailman/listinfo/genome

Reply via email to