Dear Professor, Below is the first two human intron record that I download from UCSC: >hg19_knownGene_uc001aaa.3 range=chr1:12228-13220 5'pad=0 3'pad=0 strand=+ >repeatMasking=none gtaagtagtgcttgtgctcatctccttggctgtgatacgtggccggccct cgctccagcagctggacccctacctgccgtctgctgccatcggagcccaa agccgggctgtgactgctcagaccagccggctggagggaggggctcagca ggtctggctttggccctgggagagcaggtggaagatcaggcaggccatcg ctgccacagaacccagtggattggcctaggtgggatctctgagctcaaca agccctctctgggtggtaggtgcagagacgggaggggcagagccgcaggc acagccaagagggctgaagaaatggtagaacggagcagctggtgatgtgt gggcccaccggccccaggctcctgtctccccccaggtgagaggagagtag acagtgagtgggagtggcgtcgcccctagggctctacggggccggcgtct cctgtctcctggagaggcttcgatgcccctccacaccctcttgatcttcc ctgtgatgtcatctggagccctgctgcttgcggtggcctataaagcctcc tagtctggctccaaggcctggcagagtctttcccagggaaagctacaagc agcaaacagtctgcatgggtcatccccttcactcccagctcagagcccag gccaggggcccccaagaaaggctctggtggagaacctgtgcatgaaggct gtcaaccagtccataggcaagcctggctgcctccagctgggtcgacagac aggggctggagaaggggagaagaggaaagtgaggttgcctgccctgtctc ctacctgaggctgaggaaggagaaggggatgcactgttggggaggcagct gtaactcaaagccttagcctctgttcccacgaag >hg19_knownGene_uc010nxr.1 range=chr1:12228-13220 5'pad=0 3'pad=0 strand=+ >repeatMasking=none gtaagtagtgcttgtgctcatctccttggctgtgatacgtggccggccct cgctccagcagctggacccctacctgccgtctgctgccatcggagcccaa agccgggctgtgactgctcagaccagccggctggagggaggggctcagca ggtctggctttggccctgggagagcaggtggaagatcaggcaggccatcg ctgccacagaacccagtggattggcctaggtgggatctctgagctcaaca agccctctctgggtggtaggtgcagagacgggaggggcagagccgcaggc acagccaagagggctgaagaaatggtagaacggagcagctggtgatgtgt gggcccaccggccccaggctcctgtctccccccaggtgtgtggtgatgcc aggcatgcccttccccaggtgagtgtccccagtgttgcagaggtgagagg agagtagacagtgagtgggagtggcgtcgcccctagggctctacggggcc ggcgtctcctgtctcctggagaggcttcgatgcccctccacaccctcttg atcttccctgtgatgtcatctggagccctgctgcttgcggtggcctataa agcctcctagtctggctccaaggcctggcagagtctttcccagggaaagc tacaagcagcaaacagtctgcatgggtcatccccttcactcccagctcag agcccaggccaggggcccccaagaaaggctctggtggagaacctgtgcat gaaggctgtcaaccagtccataggcaagcctggctgcctccagctgggtc gacagacaggggctggagaaggggagaagaggaaagtgaggttgcctgcc ctgtctcctacctgaggctgaggaaggagaaggggatgcactgttgggga ggcagctgtaactcaaagccttagcctctgttcccacgaag
Both of the records shown the range from chr1:12228-13220. However, when I check the nucleotide of chr1:12228-13220 only hg19_knownGene_uc010nxr.1 shown the exactly nucleotide match with the chr1:12228-13220. Can I know how I can judge whether which records to use for my research purpose in order to identify the 3'-UTR, 5'-UTR, intron, rRNA, tRNA, etc. Many thanks and looking forward from your advice. best regards Edge From: Steve Heitner <[email protected]> To: 'Edge Edge' <[email protected]>; [email protected] Sent: Wednesday, June 27, 2012 2:16 AM Subject: RE: [Genome] Help with extract rRNA, tRNA, 3'-UTR and 5'-UTR from UCSC Genome Browser Hello, Edge. I repeated the steps you provided and I did not encounter a discrepancy between the coordinates of the two queries. I would also like to add that you do not need to set "group" to "All Tables" in order to use the rmsk table. You can set "group" to "Variation and Repeats" and set "track" to "RepeatMasker". If you would like the coordinates of 5' UTR and 3' UTR regions, you will need to use a gene track like UCSC Genes or RefSeq Genes. You can do so by performing the following steps: 1. Set the following options: Group: Genes and Gene Prediction Tracks Track: UCSC Genes Table: knownGene Output format: sequence 2. Click the "get output" button 3. Select "genomic" and click the "submit" button 4. Check the "5' UTR Exons" and "3' UTR Exons" checkboxes and select any other options you desire 5. Click the "get sequence" button Note that the output here will not distinguish 5' UTR sequences from 3' UTR sequences. If you want to distinguish 5' UTR sequences from 3' UTR sequences, you will want to make two separate queries. Please contact us again at [email protected] if you have any further questions. --- Steve Heitner UCSC Genome Bioinformatics Group -----Original Message----- From: [email protected] [mailto:[email protected]] On Behalf Of Edge Edge Sent: Tuesday, June 26, 2012 8:41 AM To: [email protected] Cc: [email protected] Subject: [Genome] Help with extract rRNA, tRNA, 3'-UTR and 5'-UTR from UCSC Genome Browser Dear Professor, Can I know that how to extract the information (such as chromosome number, position start and position ) of human hg19 3'-UTR, 5'-UTR, rRNA, tRNA from UCSC Genome Browser? I got extract rRNA and tRNA by using the following method: * Select "All Tables" from the group drop-down list * Select the "rmsk" table from the table drop-down list * Choose "GTF" as the output format / Choose "Sequence" as the output format * Type a filename in "output file" so your browser downloads the result * Click "create" next to filter * Next to "repClass," type rRNA * Next to free-form query, select "OR" and type repClass = "tRNA" * Click submit on that page, then get output on the main page However, when I check the position of rRNA and tRNA in GTF format and Sequence format. It shown difference nucleotide. Can I know how to solve this issue? I just wanna to make sure the position of rRNA and tRNA in GTF format is tally with the position and chromosome shown in Sequence format. Can I know how to get all the info regarding human hg19 3'-UTR, 5'-UTR, rRNA, tRNA from UCSC Genome Browser? Many thanks for any advice. best regards Edge Research Student _______________________________________________ Genome maillist - [email protected] https://lists.soe.ucsc.edu/mailman/listinfo/genome _______________________________________________ Genome maillist - [email protected] https://lists.soe.ucsc.edu/mailman/listinfo/genome
