sLengths <- with(dataFrame, nchar(as.character(SEQUENCE)))
Bill Venables CSIRO Laboratories PO Box 120, Cleveland, 4163 AUSTRALIA Office Phone (email preferred): +61 7 3826 7251 Fax (if absolutely necessary): +61 7 3826 7304 Mobile: +61 4 8819 4402 Home Phone: +61 7 3286 7700 mailto:[EMAIL PROTECTED] http://www.cmis.csiro.au/bill.venables/ -----Original Message----- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED] On Behalf Of João Fadista Sent: Wednesday, 5 September 2007 11:51 PM To: r-help@stat.math.ethz.ch Subject: [R] length of a string Dear all, I would like to know how can I compute the length of a string in a dataframe. Example: SEQUENCE ID TGCTCCCATCTCCACGG HR04FS000000645 ACTGAACTCCCATCTCCAAT HR00000595847847 I would like to know how to compute the length of each SEQUENCE. Best regards, João Fadista [[alternative HTML version deleted]] ______________________________________________ R-help@stat.math.ethz.ch mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
