Hi, sapply(levels(df[,"SEQUENCE"]), nchar)
Where 'df' is your data.frame -- Henrique Dallazuanna Curitiba-Paraná-Brasil 25° 25' 40" S 49° 16' 22" O On 05/09/07, João Fadista <[EMAIL PROTECTED]> wrote: > > Dear all, > > I would like to know how can I compute the length of a string in a > dataframe. Example: > > SEQUENCE ID > TGCTCCCATCTCCACGG HR04FS000000645 > ACTGAACTCCCATCTCCAAT HR00000595847847 > > I would like to know how to compute the length of each SEQUENCE. > > > Best regards, > João Fadista > > [[alternative HTML version deleted]] > > > ______________________________________________ > R-help@stat.math.ethz.ch mailing list > https://stat.ethz.ch/mailman/listinfo/r-help > PLEASE do read the posting guide > http://www.R-project.org/posting-guide.html > and provide commented, minimal, self-contained, reproducible code. > > [[alternative HTML version deleted]]
______________________________________________ R-help@stat.math.ethz.ch mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
