On 05-Sep-07 13:50:57, João Fadista wrote: > Dear all, > > I would like to know how can I compute the length of a string in a > dataframe. Example: > > SEQUENCE ID > TGCTCCCATCTCCACGG HR04FS000000645 > ACTGAACTCCCATCTCCAAT HR00000595847847 > > I would like to know how to compute the length of each SEQUENCE. > > Best regards, > João Fadista
nchar("ACTGAACTCCCATCTCCAAT") [1] 20 seems to work. Find it, and related functions, with help.search("character") As it happens, help.search("string") will not help! Best wishes, Ted. -------------------------------------------------------------------- E-Mail: (Ted Harding) <[EMAIL PROTECTED]> Fax-to-email: +44 (0)870 094 0861 Date: 05-Sep-07 Time: 15:05:22 ------------------------------ XFMail ------------------------------ ______________________________________________ R-help@stat.math.ethz.ch mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.