Hi Hirra,

I've tried with the data you pisted below using pegas 0.12 and I was not able 
to repeat your results: I found that seqs. 1 and 3 are grouped in the same 
haplotype (not 1 and 2). Anyway, this is the same issue that you pointed out a 
few days ago: seq. 3 could be grouped with seq. 1 or seq. 2. I have now 
implemented the changes I described in my previous message, and have just 
pushed pegas 0.12-999 on GitHub. This also include changes to make pegas work 
with R 4.0.0 (see the results of R CMD check on CRAN for details). This new 
version will be submitted to CRAN in a few days as pegas 0.13. In the meantime, 
don't hesitate to try this new version!

Best,

Emmanuel

----- Le 3 Mar 20, à 21:00, Hirra Farooq [email protected] 
a écrit :

> Hello,
> 
> I have a question about the pegas haplotype algorithm and would be grateful if
> someone could explain.
> 
> I used pegas haplotype() on a set of sequences. I then manually aligned and
> looked at the sequences within each haplotype. For one haplotype I noticed
> something odd (see image below)
> 
> Although there was a single bp difference at the highlighted position ,these
> sequences had all been assigned as one haplotype. I understand that for the 
> 3rd
> sequence because there are gaps at this highlighted position this can lead it
> to be pooled with others, but I do not understand how sequence 1 and 2 can be
> in the same haplotype?
> 
> I would be grateful for any guidance,
> 
> 
> 
> 
> 
> 
> GBSP11539-19|Ophlitaspon[1]
> AATACTGCATTTTTTGACCCTGCAGGGGGAGGAGACCCCATTTTATATCAACATTTATTT   660
> GBSP11518-19|Ophlitaspon[2]
> AATACTGCATTTTTTGACCCTGCGGGGGGAGGAGACCCCATTTTA---------------   645
> GBSP11504-19|Ophlitaspon[3]
> AATACTGCAT--------------------------------------------------   580
> GBSP11512-19|Ophlitaspon[4]
> AATACTGCATTTTTTGACCCTGCAGGGGGAGGAGACCCATTTATATCACTTTATTTGTT-   659
>                                 **********
> 
> Best wishes
> Hirra
> University of Manchester Student.
> 
>       [[alternative HTML version deleted]]
> 
> _______________________________________________
> R-sig-phylo mailing list - [email protected]
> https://stat.ethz.ch/mailman/listinfo/r-sig-phylo
> Searchable archive at http://www.mail-archive.com/[email protected]/

_______________________________________________
R-sig-genetics mailing list
[email protected]
https://stat.ethz.ch/mailman/listinfo/r-sig-genetics

Reply via email to