Re: s:g/T/U/ doesn't work ?
Marc (): hello perl6 people, On This is perl6 version 2012.09.1 built on parrot 4.6.0 revision 0 When i try to run use v6; use Test; for 'GATGGAACTTGACTACGTAAATT' { s:g/T/U/; is $_ , 'GAUGGAACUUGACUACGUAAAUU' , 'RNA'; } I get Cannot assign to a non-container in sub infix:= at src/gen/CORE.setting:11692 in block at /tmp/ZZZ:4 As far as i understand from the doc, s:g/T/U/ is a valid syntax. any idea? It's valid syntax. The error you're getting is not a syntax error; it's a run-time error complaining about assigning to something that isn't a container. What you're assigning to is 'GATGGAACTTGACTACGTAAATT', a Str object. That's a bit like trying to assign to the number 5. It should produce an error, and it does. You need to put it into a variable, or an array element, or a hash value -- in short, a container -- for it to work. I think part of what felt confusing about this is that you did things in a 'for' loop, so the assignment directly to a Str isn't that obvious. By the way, that 'for' loop over a single element is usually spelled 'given' in Perl 6. I would write your code like this: use v6; use Test; { $_ = 'GATGGAACTTGACTACGTAAATT'; s:g/T/U/; is $_, 'GAUGGAACUUGACUACGUAAAUU', 'RNA'; } // Carl
Re: s:g/T/U/ doesn't work ?
On Wed, Oct 24, 2012 at 5:35 AM, Marc Chantreux kha...@phear.org wrote: Cannot assign to a non-container in sub infix:= at src/gen/CORE.setting:11692 in block at /tmp/ZZZ:4 you're attempting to modify a string constant, which cannot be modified. try something like (untested): my $snippet = 'GATGGAACTTGACTACGTAAATT'; for $snippet { ... ~jerry
Re: s:g/T/U/ doesn't work ?
I imagine it's the same problem as this Perl 5 code: use Test::More; for ('GATGGAACTTGACTACGTAAATT') { s/T/U/g; is $_, 'GAUGGAACUUGACUACGUAAAUU', 'RNA'; } Since $_ is an alias for each element of the list and the only element in the list is a constant string and you can't modify constants, you get the error. Changing your code to: use v6; use Test; my $x = 'GATGGAACTTGACTACGTAAATT'; for $x { s:g/T/U/; is $_ , 'GAUGGAACUUGACUACGUAAAUU' , 'RNA'; } Does indeed work. Though, if what I said is true, the error message is Less Than Awesome. I wonder could it be made more helpful? Hope this helps, -Scott On Wed, Oct 24, 2012 at 7:35 AM, Marc Chantreux kha...@phear.org wrote: hello perl6 people, On This is perl6 version 2012.09.1 built on parrot 4.6.0 revision 0 When i try to run use v6; use Test; for 'GATGGAACTTGACTACGTAAATT' { s:g/T/U/; is $_ , 'GAUGGAACUUGACUACGUAAAUU' , 'RNA'; } I get Cannot assign to a non-container in sub infix:= at src/gen/CORE.setting:11692 in block at /tmp/ZZZ:4 As far as i understand from the doc, s:g/T/U/ is a valid syntax. any idea? regards marc
Re: s:g/T/U/ doesn't work ?
hello again, i felt dumb reading your answers! it seems obvious now. thanks everyone. regards