Bug#854546: gajim: Maybe a Python bug?

[Nicolas Patrois]

Package: gajim
Version: 0.16.8-2
Followup-For: Bug #854546

Dear Maintainer,

I suspect a Python bug because it strongly looks like a similar bug in 
python-numpy (Python 2.7).
See bug #855535.
Can you run import numpy in a Python shell?

-- System Information:
Debian Release: 9.0
  APT prefers unstable
  APT policy: (500, 'unstable')
Architecture: i386 (i686)

Kernel: Linux 4.3.0-1-686-pae (SMP w/3 CPU cores)
Locale: LANG=fr_FR.UTF-8, LC_CTYPE=fr_FR.UTF-8 (charmap=UTF-8), 
LANGUAGE=fr_FR:fr:en_GB:en (charmap=UTF-8)
Shell: /bin/sh linked to /bin/dash
Init: systemd (via /run/systemd/system)

Versions of packages gajim depends on:
ii  dnsutils1:9.10.3.dfsg.P4-12.3
ii  python  2.7.13-2
ii  python-gtk2 2.24.0-5.1
ii  python-nbxmpp   0.5.4-1
ii  python-openssl  16.2.0-1
ii  python-pyasn1   0.1.9-2

Versions of packages gajim recommends:
ii  alsa-utils  1.1.3-1
ii  ca-certificates 20161130+nmu1
it  dbus1.10.18-1
ii  dunst [notification-daemon] 1.1.0-2+b1
ii  gnome-flashback [notification-daemon]   3.22.0-3
ii  gnome-shell [notification-daemon]   3.22.3-3
ii  notification-daemon 3.20.0-1+b1
ii  plasma-workspace [notification-daemon]  4:5.8.7-1
ii  pulseaudio-utils10.0-1
ii  python-crypto   2.6.1-7
ii  python-dbus 1.2.4-1+b1
ii  sox 14.4.1-5+b2
ii  xfce4-notifyd [notification-daemon] 0.3.6-1

Versions of packages gajim suggests:
ii  aspell-de-1901 [aspell-dictionary]  1:2-31
ii  aspell-en [aspell-dictionary]   2016.11.20-0-0.1
ii  aspell-fr [aspell-dictionary]   0.50-3-8
ii  avahi-daemon0.6.32-2
ii  dvipng  1.14-2+b3
ii  gnome-keyring   3.20.0-3
pn  gstreamer0.10-plugins-ugly  
pn  kwalletcli  
ii  libgtkspell02.0.16-1.1
ii  libxss1 1:1.2.2-1
ii  nautilus-sendto 3.8.4-2+b1
iu  network-manager 1.8.0-4
ii  python-avahi0.6.32-2
ii  python-gconf2.28.1+dfsg-1.2
ii  python-gnome2   2.28.1+dfsg-1.2
ii  python-gnomekeyring 2.32.0+dfsg-3
pn  python-gupnp-igd
pn  python-kerberos 
ii  python-pycurl   7.43.0-2
ii  texlive-latex-base  2016.20170123-5

-- no debconf information

Bug#865007: marked as done (libtabixpp FTBFS with htslib 1.4.1-2: devlibs error: There is no package matching [libhts2-dev] and noone provides it)

[Debian Bug Tracking System]

Your message dated Sun, 18 Jun 2017 17:42:53 +
with message-id 
and subject line Bug#865007: fixed in libtabixpp 1.0.0-3
has caused the Debian Bug report #865007,
regarding libtabixpp FTBFS with htslib 1.4.1-2: devlibs error: There is no 
package matching [libhts2-dev] and noone provides it
to be marked as done.

This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.

(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)


-- 
865007: http://bugs.debian.org/cgi-bin/bugreport.cgi?bug=865007
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---
Source: libtabixpp
Version: 1.0.0-2
Severity: serious

https://tests.reproducible-builds.org/debian/rb-pkg/unstable/amd64/libtabixpp.html
https://buildd.debian.org/status/fetch.php?pkg=libtabixpp=mips=1.0.0-2=1497795657=0

...
make[1]: Entering directory '/build/1st/libtabixpp-1.0.0'
ln -s libtabixpp.so.* libtabixpp.so
d-shlibmove --commit \
--multiarch \
--devunversioned \
--override s/libhts1-dev/libhts-dev/ \
--movedev "*.hpp" usr/include/ \
libtabixpp.so
Library package automatic movement utility
devlibs error: There is no package matching [libhts2-dev] and noone provides 
it, please report bug to d-shlibs maintainer
debian/rules:10: recipe for target 'override_dh_auto_install' failed
make[1]: *** [override_dh_auto_install] Error 1


The --override parameter needs an libhts1-dev -> libhts2-dev.
--- End Message ---
--- Begin Message ---
Source: libtabixpp
Source-Version: 1.0.0-3

We believe that the bug you reported is fixed in the latest version of
libtabixpp, which is due to be installed in the Debian FTP archive.

A summary of the changes between this version and the previous one is
attached.

Thank you for reporting the bug, which will now be closed.  If you
have further comments please address them to 865...@bugs.debian.org,
and the maintainer will reopen the bug report if appropriate.

Debian distribution maintenance software
pp.
Sascha Steinbiss  (supplier of updated libtabixpp package)

(This message was generated automatically at their request; if you
believe that there is a problem with it please contact the archive
administrators by mailing ftpmas...@ftp-master.debian.org)


-BEGIN PGP SIGNED MESSAGE-
Hash: SHA256

Format: 1.8
Date: Sun, 18 Jun 2017 17:06:51 +
Source: libtabixpp
Binary: libtabixpp0 libtabixpp-dev libtabixpp0-dbg
Architecture: source amd64
Version: 1.0.0-3
Distribution: unstable
Urgency: medium
Maintainer: Debian Med Packaging Team 

Changed-By: Sascha Steinbiss 
Description:
 libtabixpp-dev - C++ wrapper to tabix indexer (development files)
 libtabixpp0 - C++ wrapper to tabix indexer
 libtabixpp0-dbg - C++ wrapper to tabix indexer (debug symbols)
Closes: 865007
Changes:
 libtabixpp (1.0.0-3) unstable; urgency=medium
 .
   * Fix FTBFS with htslib 1.4.1-2.
 Closes: #865007
   * Update uploader email address.
   * Bump Standards-Version.
   * Use secure Vcs-Git.
Checksums-Sha1:
 c4cc9edaf2cf23e7f55008d0ef1fb99adc533a64 1853 libtabixpp_1.0.0-3.dsc
 7fc703e0a909e9adab78e715ad70a5dd877e2bbb 46844 libtabixpp_1.0.0-3.debian.tar.xz
 b7a3bda9ab76a9059e29d847c606ba765f487ddc 6968 libtabixpp-dev_1.0.0-3_amd64.deb
 a364b42a54408cfd10b7fefa711da6b366d995a6 47098 
libtabixpp0-dbg_1.0.0-3_amd64.deb
 8b6d1d3e249b894c8c12915e68188ca3f3b1cf37 7624 libtabixpp0_1.0.0-3_amd64.deb
 9d44f075459eba81082759b5d6a38eb30e786c5c 6434 
libtabixpp_1.0.0-3_amd64.buildinfo
Checksums-Sha256:
 3ff905b24302efcd73a465828b597502dfa7f1c50bc654a4ae7c59ced2f2c3b7 1853 
libtabixpp_1.0.0-3.dsc
 8efa56084db54f3809e29a58d5d4f8615dc71a4af580a7094082cc915160d3b4 46844 
libtabixpp_1.0.0-3.debian.tar.xz
 96d89f7f3ba73f443f18ce4e8864dc10bf8fc4a7b882139dd74ef17ed5f55879 6968 
libtabixpp-dev_1.0.0-3_amd64.deb
 07ee54a62bb749bf08dca6244fe079ad5237385b326f055582b6a46bd577cf4b 47098 
libtabixpp0-dbg_1.0.0-3_amd64.deb
 7e29bbb2a8a6c7e1e294e9faad94373793e9f83458b1de94ad5fa9bede8bbfc6 7624 
libtabixpp0_1.0.0-3_amd64.deb
 6588dec8cd8bfbd49f11696d08dfe42cafc2f20f1050fc438c3916ed71e3d5e1 6434 
libtabixpp_1.0.0-3_amd64.buildinfo
Files:
 dc32e718d482ff9ddf1375a5f2394a9c 1853 science optional libtabixpp_1.0.0-3.dsc
 fb196a29b9989e709b39f81a69dfd35f 46844 science optional 
libtabixpp_1.0.0-3.debian.tar.xz
 1373f69e280108d5be71868b3c876688 6968 libdevel optional 
libtabixpp-dev_1.0.0-3_amd64.deb
 1336dbe971a786de4b9bd71ca886bd67 47098 debug extra 
libtabixpp0-dbg_1.0.0-3_amd64.deb
 dbad120bc2520ba0ec76e45b717a8a71 7624 libs optional 

Bug#865015: debian-installer: Live installers are unable to start, "There was a problem reading data from the CD-ROM"

[Francisco Gómez]

Package: debian-installer
Severity: grave
Justification: renders package unusable

When trying to install Debian, the installer is unable to start, and the
following error appears:

"There was an error reading data from the CD-ROM. Please make sure it is in the
drive. If retrying does not work, you should check the integrity of your CD-
ROM."

Retrying does not solve the problem. On the console, with an AMD64 image, the
following output is displayed:

cdrom-retriever: error: Unable to find
`/w/work/free/gnomepool/main/libl/libzlo2-2-udeb/libzlo2-2-udeb_2.08-1.2+b2_amd64.udeb`

This has been tested with the live image "debian-9.0.0-amd64-i386-netinst.iso"
on multiple machines by multiple people, including on my iMac via Virtualbox,
downloaded from torrent.



-- System Information:
Debian Release: 9.0
  APT prefers stable
  APT policy: (500, 'stable')
Architecture: amd64 (x86_64)

Kernel: Linux 4.9.0-3-amd64 (SMP w/1 CPU core)
Locale: LANG=en_US.UTF-8, LC_CTYPE=en_US.UTF-8 (charmap=UTF-8), 
LANGUAGE=en_US.UTF-8 (charmap=UTF-8)
Shell: /bin/sh linked to /bin/dash
Init: systemd (via /run/systemd/system)

Bug#865015: debian-installer: Live installers are unable to start, "There was a problem reading data from the CD-ROM"

[Francisco Gómez García]

Sorry, there was a typo. I said that the ISO I tested is 
"debian-9.0.0-amd64-i386-netinst.iso”, however it was
"debian-live-9.0.0-amd64-gnome.iso”.

BTW, here are two screenshots showing the mentioned errors:

https://matrix.org/_matrix/media/v1/download/matrix.org/bWUljOUExCCXNbTfKonuQYVS
https://matrix.org/_matrix/media/v1/download/matrix.org/sutYvgXzGYRKJRVbkeWFsIGY

On Sun, 18 Jun 2017 18:09:14 + Francisco Gómez  
wrote:
> Package: debian-installer
> Severity: grave
> Justification: renders package unusable
> 
> When trying to install Debian, the installer is unable to start, and the
> following error appears:
> 
> "There was an error reading data from the CD-ROM. Please make sure it is in 
> the
> drive. If retrying does not work, you should check the integrity of your CD-
> ROM."
> 
> Retrying does not solve the problem. On the console, with an AMD64 image, the
> following output is displayed:
> 
> cdrom-retriever: error: Unable to find
> `/w/work/free/gnomepool/main/libl/libzlo2-2-udeb/libzlo2-2-udeb_2.08-1.2+b2_amd64.udeb`
> 
> This has been tested with the live image "debian-9.0.0-amd64-i386-netinst.iso"
> on multiple machines by multiple people, including on my iMac via Virtualbox,
> downloaded from torrent.
> 
> 
> 
> -- System Information:
> Debian Release: 9.0
>   APT prefers stable
>   APT policy: (500, 'stable')
> Architecture: amd64 (x86_64)
> 
> Kernel: Linux 4.9.0-3-amd64 (SMP w/1 CPU core)
> Locale: LANG=en_US.UTF-8, LC_CTYPE=en_US.UTF-8 (charmap=UTF-8), 
> LANGUAGE=en_US.UTF-8 (charmap=UTF-8)
> Shell: /bin/sh linked to /bin/dash
> Init: systemd (via /run/systemd/system)
> 
> 

Bug#856147: marked as done (dash-el: Incomplete debian/copyright?)

[Debian Bug Tracking System]

Your message dated Sun, 18 Jun 2017 21:07:35 +
with message-id 
and subject line Bug#856125: fixed in dash-el 2.13.0+dfsg-2
has caused the Debian Bug report #856125,
regarding dash-el: Incomplete debian/copyright?
to be marked as done.

This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.

(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)


-- 
856125: http://bugs.debian.org/cgi-bin/bugreport.cgi?bug=856125
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---
Source: dash-el
Version: 2.13.0+dfsg-1
Severity: serious
Justication: Policy 12.5
X-Debbugs-CC: Sean Whitton 

Hi,

I just ACCEPTed dash-el from NEW but noticed it was missing 
attribution in debian/copyright for at least:

  dash-template.texi
  dash.info
  dash.texi

(This is not exhaustive so please check over the entire package 
carefully and address these on your next upload.)


Regards,

-- 
  ,''`.
 : :'  : Chris Lamb
 `. `'`  la...@debian.org / chris-lamb.co.uk
   `-
--- End Message ---
--- Begin Message ---
Source: dash-el
Source-Version: 2.13.0+dfsg-2

We believe that the bug you reported is fixed in the latest version of
dash-el, which is due to be installed in the Debian FTP archive.

A summary of the changes between this version and the previous one is
attached.

Thank you for reporting the bug, which will now be closed.  If you
have further comments please address them to 856...@bugs.debian.org,
and the maintainer will reopen the bug report if appropriate.

Debian distribution maintenance software
pp.
Sean Whitton  (supplier of updated dash-el package)

(This message was generated automatically at their request; if you
believe that there is a problem with it please contact the archive
administrators by mailing ftpmas...@ftp-master.debian.org)


-BEGIN PGP SIGNED MESSAGE-
Hash: SHA512

Format: 1.8
Date: Sun, 18 Jun 2017 21:28:34 +0100
Source: dash-el
Binary: dash-el elpa-dash
Architecture: all source
Version: 2.13.0+dfsg-2
Distribution: unstable
Urgency: medium
Maintainer: Debian Emacs addons team 

Changed-By: Sean Whitton 
Closes: 815303 850056 856125
Description: 
 dash-el- transitional dummy package for elpa-dash
 elpa-dash  - Modern list manipulation library for Emacs
Changes:
 dash-el (2.13.0+dfsg-2) unstable; urgency=medium
 .
   * Add d/dash-el.maintscript to remove obsolete 50dash-el.el site start 
script.
   * Add copyright stanza for *.info and *.texi files (Closes: #856125).
 Thanks to Chris Lamb for catching this.
   * Add additional copyright years for the FSF (files in dev/).
 .
 dash-el (2.13.0+dfsg-1) experimental; urgency=medium
 .
   [ Rémi Vanicat & Sean Whitton ]
   * Convert package build to use dh_elpa (Closes: #850056, #815303).
 Binary package renamed dash-el -> elpa-dash with transitional binary
 package provided.
 - Rewrite d/rules.
 - Drop d/emacsen-*.
 - Drop d/install.
 - Add d/elpa-test.
 - Add d/elpa-dash.elpa.
   * Split dash-functional.el into its own source package, dash-functional-el.
 dash.el and dash-functional.el have different ELPA package version.
 .
   [ Rémi Vanicat ]
   * Add d/elpa-dash.info to install upstream's info file.
 .
   [ Sean Whitton ]
   * Adopt on behalf of the pkg-emacsen team.
 - Move Hajime Mizuno to Uploaders.
 - Add myself as an uploader.
   * Repack source to remove rainbow-dash.png.
 Copyright status unknown.
 - Add Files-Excluded field to d/copyright.
 - Add dversionmangle to d/watch.
   * d/copyright updates:
 - Add Rémi Vanicat and Sean Whitton to stanza for debian/.
 - Correct upstream's copyright Magnar Sveen -> FSF (see file headers).
   * Bump debhelper compat & build-dep to 10.
   * Uncomment & update Vcs-* fields.
Checksums-Sha1: 
 134b04c14b4ce399d2a1e685f06107d2e0f03740 2178 dash-el_2.13.0+dfsg-2.dsc
 b0c548b3296c12776a12535d2da904513206e042 2680 
dash-el_2.13.0+dfsg-2.debian.tar.xz
 c1dc78f39212e56f740d050240d958c7bd5bde35 25562 dash-el_2.13.0+dfsg-2_all.deb
 9813d0163a5d230b9c6219fb9ab87d748d366654 7397 
dash-el_2.13.0+dfsg-2_i386.buildinfo
 fa3e0553055a78d87ecd783a1674d4492e814559 46480 elpa-dash_2.13.0+dfsg-2_all.deb
Checksums-Sha256: 
 f7214a401ac270a98ace72971a1ddcbb34ded8bb7d10e59df90479aa2c8d87b9 2178 
dash-el_2.13.0+dfsg-2.dsc
 6ef64f47f4f87da1e54e1c0f70b9016d7d2575f22d44a8cfabf9b8e46501245a 2680 
dash-el_2.13.0+dfsg-2.debian.tar.xz
 86db3ec8f7acdd1e89c447d8f945542dfc26fe4803f729cf1138e1a667860b70 25562 
dash-el_2.13.0+dfsg-2_all.deb
 

Bug#865006: marked as done (bcftools FTBFS with htslib 1.4.1-2: [E::hts_idx_push] Region 536870912..536870913 cannot be stored in a tbi index. Try using a csi index with min_shift = 14, n_lvls >= 6)

[Debian Bug Tracking System]

Your message dated Sun, 18 Jun 2017 21:05:43 +
with message-id 
and subject line Bug#865006: fixed in bcftools 1.4.1-1
has caused the Debian Bug report #865006,
regarding bcftools FTBFS with htslib 1.4.1-2: [E::hts_idx_push] Region 
536870912..536870913 cannot be stored in a tbi index. Try using a csi index 
with min_shift = 14, n_lvls >= 6
to be marked as done.

This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.

(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)


-- 
865006: http://bugs.debian.org/cgi-bin/bugreport.cgi?bug=865006
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---
Source: bcftools
Version: 1.3.1-1
Severity: serious
Tags: buster sid

https://tests.reproducible-builds.org/debian/rb-pkg/unstable/amd64/bcftools.html
https://buildd.debian.org/status/fetch.php?pkg=bcftools=mips=1.3.1-1=1497794613=0

...
test_tabix:
/build/1st/bcftools-1.3.1/bcftools view -H /tmp/nSKFihjHTO/merge.a.bcf 
1:3000151-3000151
.. ok

[E::hts_idx_push] Region 536870912..536870913 cannot be stored in a tbi index. 
Try using a csi index with min_shift = 14, n_lvls >= 6
tbx_index_build failed: /tmp/nSKFihjHTO/large_chrom_tbi_limit.vcf.gz
The command failed: /usr/bin/tabix -f -p vcf 
/tmp/nSKFihjHTO/large_chrom_tbi_limit.vcf.gz
 at ./test/test.pl line 259.
main::error("The command failed: /usr/bin/tabix -f -p vcf 
/tmp/nSKFihjHTO/"..., "") called at ./test/test.pl line 315
main::cmd("/usr/bin/tabix -f -p vcf 
/tmp/nSKFihjHTO/large_chrom_tbi_limi"...) called at ./test/test.pl line 406
main::bgzip_tabix(HASH(0x564bf0d26f48), "file", 
"large_chrom_tbi_limit", "suffix", "vcf", "args", "-p vcf") called at 
./test/test.pl line 414
main::bgzip_tabix_vcf(HASH(0x564bf0d26f48), "large_chrom_tbi_limit") 
called at ./test/test.pl line 423
main::test_tabix(HASH(0x564bf0d26f48), "in", "large_chrom_tbi_limit", 
"reg", "chr11:1-536870912", "out", "large_chrom_tbi_limit.20.1.536870912.out") 
called at ./test/test.pl line 39
Makefile:102: recipe for target 'test' failed
make[1]: *** [test] Error 1
make[1]: Leaving directory '/build/1st/bcftools-1.3.1'
dh_auto_test: make -j16 test returned exit code 2
debian/rules:11: recipe for target 'build' failed
make: *** [build] Error 2
--- End Message ---
--- Begin Message ---
Source: bcftools
Source-Version: 1.4.1-1

We believe that the bug you reported is fixed in the latest version of
bcftools, which is due to be installed in the Debian FTP archive.

A summary of the changes between this version and the previous one is
attached.

Thank you for reporting the bug, which will now be closed.  If you
have further comments please address them to 865...@bugs.debian.org,
and the maintainer will reopen the bug report if appropriate.

Debian distribution maintenance software
pp.
Andreas Tille  (supplier of updated bcftools package)

(This message was generated automatically at their request; if you
believe that there is a problem with it please contact the archive
administrators by mailing ftpmas...@ftp-master.debian.org)


-BEGIN PGP SIGNED MESSAGE-
Hash: SHA256

Format: 1.8
Date: Sun, 18 Jun 2017 21:41:36 +0200
Source: bcftools
Binary: bcftools
Architecture: source amd64
Version: 1.4.1-1
Distribution: unstable
Urgency: medium
Maintainer: Debian Med Packaging Team 

Changed-By: Andreas Tille 
Description:
 bcftools   - genomic variant calling and manipulation of VCF/BCF files
Closes: 865006
Changes:
 bcftools (1.4.1-1) unstable; urgency=medium
 .
   * Team upload
   * New upstream version
 Closes: #865006
   * debhelper 10
Checksums-Sha1:
 ba3846f8c638cc88395b06c0b7f9713d12974a5b 2110 bcftools_1.4.1-1.dsc
 9becb949f1208c074a4d65a72d07cae2326d5c70 2243057 bcftools_1.4.1.orig.tar.gz
 9a78543d739f4a7efb21e84042c671744048fb70 6056 bcftools_1.4.1-1.debian.tar.xz
 2afe0e13b64c8e0246591c7f659f28c5a706c191 1185892 
bcftools-dbgsym_1.4.1-1_amd64.deb
 7c238424699557f77ffefd1fe6b5fbe1f803aec9 6452 bcftools_1.4.1-1_amd64.buildinfo
 622c6ff38d84ac741371aa5fca5086a3015da502 474004 bcftools_1.4.1-1_amd64.deb
Checksums-Sha256:
 6aecbb8b2c6114a3e74c6100226d5b0347a58c2ec13b5f61fcc147af611f4f00 2110 
bcftools_1.4.1-1.dsc
 2f01e079efd03f3ff900d55ff394746741947c2492058bb2bf5c5f914ab744b1 2243057 
bcftools_1.4.1.orig.tar.gz
 554a93b19e6ef50a1dd7b008230c608ea2340cb88b12fac8865fa42ed89a1384 6056 
bcftools_1.4.1-1.debian.tar.xz
 ab22f1678f9514bc922889e4d7bb1551ef83f2ae76aa03c2d70c93e33ddc86ad 1185892 
bcftools-dbgsym_1.4.1-1_amd64.deb
 ea69778983da9578af19428d0ce406ac38d22d2328acc56376f5fcd38df8 6452 

Bug#856125: marked as done (dash-el: Incomplete debian/copyright?)

[Debian Bug Tracking System]

Your message dated Sun, 18 Jun 2017 21:07:35 +
with message-id 
and subject line Bug#856125: fixed in dash-el 2.13.0+dfsg-2
has caused the Debian Bug report #856125,
regarding dash-el: Incomplete debian/copyright?
to be marked as done.

This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.

(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)


-- 
856125: http://bugs.debian.org/cgi-bin/bugreport.cgi?bug=856125
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---
Source: dash-el
Version: 2.13.0+dfsg-1
Severity: serious
Justication: Policy 12.5
X-Debbugs-CC: Sean Whitton 

Hi,

I just ACCEPTed dash-el from NEW but noticed it was missing 
attribution in debian/copyright for at least:

  dash-template.texi
  dash.info
  dash.texi

(This is not exhaustive so please check over the entire package 
carefully and address these on your next upload.)


Regards,

-- 
  ,''`.
 : :'  : Chris Lamb
 `. `'`  la...@debian.org / chris-lamb.co.uk
   `-
--- End Message ---
--- Begin Message ---
Source: dash-el
Source-Version: 2.13.0+dfsg-2

We believe that the bug you reported is fixed in the latest version of
dash-el, which is due to be installed in the Debian FTP archive.

A summary of the changes between this version and the previous one is
attached.

Thank you for reporting the bug, which will now be closed.  If you
have further comments please address them to 856...@bugs.debian.org,
and the maintainer will reopen the bug report if appropriate.

Debian distribution maintenance software
pp.
Sean Whitton  (supplier of updated dash-el package)

(This message was generated automatically at their request; if you
believe that there is a problem with it please contact the archive
administrators by mailing ftpmas...@ftp-master.debian.org)


-BEGIN PGP SIGNED MESSAGE-
Hash: SHA512

Format: 1.8
Date: Sun, 18 Jun 2017 21:28:34 +0100
Source: dash-el
Binary: dash-el elpa-dash
Architecture: all source
Version: 2.13.0+dfsg-2
Distribution: unstable
Urgency: medium
Maintainer: Debian Emacs addons team 

Changed-By: Sean Whitton 
Closes: 815303 850056 856125
Description: 
 dash-el- transitional dummy package for elpa-dash
 elpa-dash  - Modern list manipulation library for Emacs
Changes:
 dash-el (2.13.0+dfsg-2) unstable; urgency=medium
 .
   * Add d/dash-el.maintscript to remove obsolete 50dash-el.el site start 
script.
   * Add copyright stanza for *.info and *.texi files (Closes: #856125).
 Thanks to Chris Lamb for catching this.
   * Add additional copyright years for the FSF (files in dev/).
 .
 dash-el (2.13.0+dfsg-1) experimental; urgency=medium
 .
   [ Rémi Vanicat & Sean Whitton ]
   * Convert package build to use dh_elpa (Closes: #850056, #815303).
 Binary package renamed dash-el -> elpa-dash with transitional binary
 package provided.
 - Rewrite d/rules.
 - Drop d/emacsen-*.
 - Drop d/install.
 - Add d/elpa-test.
 - Add d/elpa-dash.elpa.
   * Split dash-functional.el into its own source package, dash-functional-el.
 dash.el and dash-functional.el have different ELPA package version.
 .
   [ Rémi Vanicat ]
   * Add d/elpa-dash.info to install upstream's info file.
 .
   [ Sean Whitton ]
   * Adopt on behalf of the pkg-emacsen team.
 - Move Hajime Mizuno to Uploaders.
 - Add myself as an uploader.
   * Repack source to remove rainbow-dash.png.
 Copyright status unknown.
 - Add Files-Excluded field to d/copyright.
 - Add dversionmangle to d/watch.
   * d/copyright updates:
 - Add Rémi Vanicat and Sean Whitton to stanza for debian/.
 - Correct upstream's copyright Magnar Sveen -> FSF (see file headers).
   * Bump debhelper compat & build-dep to 10.
   * Uncomment & update Vcs-* fields.
Checksums-Sha1: 
 134b04c14b4ce399d2a1e685f06107d2e0f03740 2178 dash-el_2.13.0+dfsg-2.dsc
 b0c548b3296c12776a12535d2da904513206e042 2680 
dash-el_2.13.0+dfsg-2.debian.tar.xz
 c1dc78f39212e56f740d050240d958c7bd5bde35 25562 dash-el_2.13.0+dfsg-2_all.deb
 9813d0163a5d230b9c6219fb9ab87d748d366654 7397 
dash-el_2.13.0+dfsg-2_i386.buildinfo
 fa3e0553055a78d87ecd783a1674d4492e814559 46480 elpa-dash_2.13.0+dfsg-2_all.deb
Checksums-Sha256: 
 f7214a401ac270a98ace72971a1ddcbb34ded8bb7d10e59df90479aa2c8d87b9 2178 
dash-el_2.13.0+dfsg-2.dsc
 6ef64f47f4f87da1e54e1c0f70b9016d7d2575f22d44a8cfabf9b8e46501245a 2680 
dash-el_2.13.0+dfsg-2.debian.tar.xz
 86db3ec8f7acdd1e89c447d8f945542dfc26fe4803f729cf1138e1a667860b70 25562 
dash-el_2.13.0+dfsg-2_all.deb
 

Bug#856126: marked as done (dash-functional-el: Incomplete debian/copyright?)

[Debian Bug Tracking System]

Your message dated Sun, 18 Jun 2017 21:07:42 +
with message-id 
and subject line Bug#856126: fixed in dash-functional-el 1.2.0+dfsg-2
has caused the Debian Bug report #856126,
regarding dash-functional-el: Incomplete debian/copyright?
to be marked as done.

This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.

(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)


-- 
856126: http://bugs.debian.org/cgi-bin/bugreport.cgi?bug=856126
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---
Source: dash-functional-el
Version: 1.2.0+dfsg-1
Severity: serious
Justication: Policy 12.5
X-Debbugs-CC: Sean Whitton 

Hi,

I just ACCEPTed dash-functional-el from NEW but noticed it was 
missing attribution in debian/copyright for at least:

  dash-template.texi
  dash.info
  dash.texi

(This is not exhaustive so please check over the entire package 
carefully and address these on your next upload.)


Regards,

-- 
  ,''`.
 : :'  : Chris Lamb
 `. `'`  la...@debian.org / chris-lamb.co.uk
   `-
--- End Message ---
--- Begin Message ---
Source: dash-functional-el
Source-Version: 1.2.0+dfsg-2

We believe that the bug you reported is fixed in the latest version of
dash-functional-el, which is due to be installed in the Debian FTP archive.

A summary of the changes between this version and the previous one is
attached.

Thank you for reporting the bug, which will now be closed.  If you
have further comments please address them to 856...@bugs.debian.org,
and the maintainer will reopen the bug report if appropriate.

Debian distribution maintenance software
pp.
Sean Whitton  (supplier of updated dash-functional-el 
package)

(This message was generated automatically at their request; if you
believe that there is a problem with it please contact the archive
administrators by mailing ftpmas...@ftp-master.debian.org)


-BEGIN PGP SIGNED MESSAGE-
Hash: SHA512

Format: 1.8
Date: Sun, 18 Jun 2017 21:06:22 +0100
Source: dash-functional-el
Binary: elpa-dash-functional
Architecture: all source
Version: 1.2.0+dfsg-2
Distribution: unstable
Urgency: medium
Maintainer: Debian Emacs addons team 

Changed-By: Sean Whitton 
Closes: 856126
Description: 
 elpa-dash-functional - collection of functional combinators for Emacs Lisp
Changes:
 dash-functional-el (1.2.0+dfsg-2) unstable; urgency=medium
 .
   * Add copyright stanza for *.info and *.texi files (Closes: #856126).
 Thanks to Chris Lamb for catching this.
Checksums-Sha1: 
 285446f3b7761c255c2f954654633ebe456cb1f7 2300 
dash-functional-el_1.2.0+dfsg-2.dsc
 735ed7cd8aca792db93730a2b5f29aa3cd033369 2124 
dash-functional-el_1.2.0+dfsg-2.debian.tar.xz
 229623badc70e34ef22b46317f62a5c074cd0062 7241 
dash-functional-el_1.2.0+dfsg-2_i386.buildinfo
 95273552a84520ed471781a0b8f34cf22efd4b06 29272 
elpa-dash-functional_1.2.0+dfsg-2_all.deb
Checksums-Sha256: 
 d702f01690788bf5b184717d0d5b32d2de5967414edfdc4b0e61eed306d2d119 2300 
dash-functional-el_1.2.0+dfsg-2.dsc
 039041407722c2af177b83d89e4ba43f320e00ac135a08106201c8aba7f6745d 2124 
dash-functional-el_1.2.0+dfsg-2.debian.tar.xz
 4fe8af38fac6db95454477a377cf2b5076bb37eb421c1389b9fb226f164b76c0 7241 
dash-functional-el_1.2.0+dfsg-2_i386.buildinfo
 3502b7a3370bbecfaca8e042772cf463c261c39a3a3c9134e69ef6c6a4337168 29272 
elpa-dash-functional_1.2.0+dfsg-2_all.deb
Files: 
 f8208512f78e84379826dffa2bb1ecd5 2300 lisp extra 
dash-functional-el_1.2.0+dfsg-2.dsc
 d5615a31beab914f587e3e80bf837f57 2124 lisp extra 
dash-functional-el_1.2.0+dfsg-2.debian.tar.xz
 9bfaf762b5caeccfbe04ba455c3e6992 7241 lisp extra 
dash-functional-el_1.2.0+dfsg-2_i386.buildinfo
 4b19aae4403706a7e8501d6889f503ed 29272 lisp extra 
elpa-dash-functional_1.2.0+dfsg-2_all.deb

-BEGIN PGP SIGNATURE-

iQIzBAEBCgAdFiEEm5FwB64DDjbk/CSLaVt65L8GYkAFAllG5ksACgkQaVt65L8G
YkDtHQ/+I75wRsNpuDlHM/mpkxPRtiZgYpbTsZEhE3L07cMPMay0GTCo0ctC/rmX
u7mbgwdzRvZ+CcvCkOfbmQ1GJUGnPpzCRO82QiCwgQ7vaEed63kYQmYm/d5m89WC
rPobteqkyhI6UuzczCpLUJhuFp3creVhk9qej4uyAd3hQT7YKvXyCg/F2659ScZD
XxZXylV4QxQ/R7bU1GGrYY3tYT8YohOkMqrwRy/iolDp4ugQAh4KoGj+sMgLfj9+
upl9jdZpz/Hy9xvhBmbmbo1wpQ+s5PDLaqPcAencml9/CjQdxxTy78xy9pzBu0A9
9z9n7tvR7zxV/0vSgvThLcrJVR0mBIqXZ1F+BJY5FEInEHXH1/CDR3ArEfTEDDwB
m0A73PVYvxp6RQQJ3u92DLQ8ynIJqUklPuKsgsZlwYOjhOPEBT5f6Tzp6saUkKba
N/1JWyPkTr4eqxXoZDuer8Fx1bIgeeTS0MEW6KWxpCT+k2cT9C+N0PF0yhEljptR
bWbRxiMU9RvKF2LBk/o0feAcd+snkc3JuLyU5UNIeeLKVsV2jd+qm06i7mcAm2rr
3am+I7Nnn+oc3MxiWBeG3JDelpplKoqKgzAO/VanCx70NBDUkAf3pmiRMzlp+53N
+7CkZvEadI8yb/mm2FbSTe4/m2/JystEJq0U3VfQIHbvyNu/gpY=
=bzn3

Bug#865014: marked as done (haskell-cabal-helper FTBFS: dh_install: Cannot find (any matches for) "dist-ghc/build/cabal-helper-wrapper-v0.7/cabal-helper-wrapper-v0.7")

[Debian Bug Tracking System]

Your message dated Mon, 19 Jun 2017 00:21:49 +
with message-id 
and subject line Bug#865014: fixed in haskell-cabal-helper 0.7.3.0-2
has caused the Debian Bug report #865014,
regarding haskell-cabal-helper FTBFS: dh_install: Cannot find (any matches for) 
"dist-ghc/build/cabal-helper-wrapper-v0.7/cabal-helper-wrapper-v0.7"
to be marked as done.

This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.

(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)


-- 
865014: http://bugs.debian.org/cgi-bin/bugreport.cgi?bug=865014
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---
Source: haskell-cabal-helper
Version: 0.7.3.0-1
Severity: serious

https://buildd.debian.org/status/package.php?p=haskell-cabal-helper=sid

...
dh_bugfiles -pcabal-helper 
dh_install -pcabal-helper 
dh_install: Cannot find (any matches for) 
"dist-ghc/build/cabal-helper-wrapper-v0.7/cabal-helper-wrapper-v0.7" (tried in 
"." and "debian/tmp")
dh_install: cabal-helper missing files: 
dist-ghc/build/cabal-helper-wrapper-v0.7/cabal-helper-wrapper-v0.7
dh_install: missing files, aborting
/usr/share/cdbs/1/rules/debhelper.mk:233: recipe for target 
'binary-install/cabal-helper' failed
make: *** [binary-install/cabal-helper] Error 2
--- End Message ---
--- Begin Message ---
Source: haskell-cabal-helper
Source-Version: 0.7.3.0-2

We believe that the bug you reported is fixed in the latest version of
haskell-cabal-helper, which is due to be installed in the Debian FTP archive.

A summary of the changes between this version and the previous one is
attached.

Thank you for reporting the bug, which will now be closed.  If you
have further comments please address them to 865...@bugs.debian.org,
and the maintainer will reopen the bug report if appropriate.

Debian distribution maintenance software
pp.
Clint Adams  (supplier of updated haskell-cabal-helper 
package)

(This message was generated automatically at their request; if you
believe that there is a problem with it please contact the archive
administrators by mailing ftpmas...@ftp-master.debian.org)


-BEGIN PGP SIGNED MESSAGE-
Hash: SHA512

Format: 1.8
Date: Sun, 18 Jun 2017 20:06:39 -0400
Source: haskell-cabal-helper
Binary: libghc-cabal-helper-dev libghc-cabal-helper-prof 
libghc-cabal-helper-doc cabal-helper
Architecture: source
Version: 0.7.3.0-2
Distribution: unstable
Urgency: medium
Maintainer: Debian Haskell Group 

Changed-By: Clint Adams 
Description:
 cabal-helper - ${haskell:ShortDescription}${haskell:ShortBlurb}
 libghc-cabal-helper-dev - ${haskell:ShortDescription}${haskell:ShortBlurb}
 libghc-cabal-helper-doc - ${haskell:ShortDescription}${haskell:ShortBlurb}
 libghc-cabal-helper-prof - ${haskell:ShortDescription}${haskell:ShortBlurb}
Closes: 865014
Changes:
 haskell-cabal-helper (0.7.3.0-2) unstable; urgency=medium
 .
   * Fix path of cabal-helper-wrapper.  closes: #865014.
Checksums-Sha1:
 7f8b765640e4c031ecf5929be848d668b8da6b7c 2796 
haskell-cabal-helper_0.7.3.0-2.dsc
 8cfe0d96ec0c2477242e8d1aff746c61f5ef7728 35745 
haskell-cabal-helper_0.7.3.0.orig.tar.gz
 8515344012e81d3b5565e5ad8e8aa02d2e090a43 14148 
haskell-cabal-helper_0.7.3.0-2.debian.tar.xz
 4dc50c6751247edda3b95db01b90b61082fe8855 7073 
haskell-cabal-helper_0.7.3.0-2_source.buildinfo
Checksums-Sha256:
 0d089b07388bbb605c703770e8d495e67d3e14c6872bc14ca94f3ee6e4eb0ee4 2796 
haskell-cabal-helper_0.7.3.0-2.dsc
 794055f5205dd029aceb2fe9aac183880d2b4ef005d1096ee3052710d01192a4 35745 
haskell-cabal-helper_0.7.3.0.orig.tar.gz
 cc502b52e687aee2d024bc59da0ef14238259a24b8029ee7cb2f7c9a9c37934f 14148 
haskell-cabal-helper_0.7.3.0-2.debian.tar.xz
 40c5df44b5d433035bf1a6899d76d83c4aa3d4a550fa8db0ce1266144cb484f8 7073 
haskell-cabal-helper_0.7.3.0-2_source.buildinfo
Files:
 5b5d2fa5c5778413bb226f5e85cbafcd 2796 haskell extra 
haskell-cabal-helper_0.7.3.0-2.dsc
 6f00c20ba699e4181f91aac9e4330e09 35745 haskell extra 
haskell-cabal-helper_0.7.3.0.orig.tar.gz
 fcd361eff10c15931b643e8231938936 14148 haskell extra 
haskell-cabal-helper_0.7.3.0-2.debian.tar.xz
 16f25f2b1308f7f8b6213e1e8634b281 7073 haskell extra 
haskell-cabal-helper_0.7.3.0-2_source.buildinfo

-BEGIN PGP SIGNATURE-
Comment: Debian!

iQKlBAEBCgCPFiEEdYHsh0BT5sgHeRubVZIzHhmdOKgFAllHFdJfFIAALgAo
aXNzdWVyLWZwckBub3RhdGlvbnMub3BlbnBncC5maWZ0aGhvcnNlbWFuLm5ldDc1
ODFFQzg3NDA1M0U2QzgwNzc5MUI5QjU1OTIzMzFFMTk5RDM4QTgRHGNsaW50QGRl
Ymlhbi5vcmcACgkQVZIzHhmdOKjm5w/+I3W79QxjjgtZEum0g0NhKvrZVkf9aWDB
Af9xAguJRUYrjHSjgWo8RPNUVMUEM+528sFNgV/g67zERxReHatxOPeizdbd7kGB

Bug#865016: marked as done (haskell-conduit FTBFS: hlibrary.setup: Encountered missing dependencies: split >=0.2.0.0)

[Debian Bug Tracking System]

Your message dated Mon, 19 Jun 2017 00:50:54 +
with message-id 
and subject line Bug#865016: fixed in haskell-conduit 1.2.10-2
has caused the Debian Bug report #865016,
regarding haskell-conduit FTBFS: hlibrary.setup: Encountered missing 
dependencies: split >=0.2.0.0
to be marked as done.

This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.

(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)


-- 
865016: http://bugs.debian.org/cgi-bin/bugreport.cgi?bug=865016
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---
Source: haskell-conduit
Version: 1.2.10-1
Severity: serious

https://buildd.debian.org/status/package.php?p=haskell-conduit=sid

...
make_setup_recipe
Running ghc --make Setup.lhs -o debian/hlibrary.setup
[1 of 1] Compiling Main ( Setup.lhs, Setup.o )
Linking debian/hlibrary.setup ...
. /usr/share/haskell-devscripts/Dh_Haskell.sh && \
configure_recipe
Running debian/hlibrary.setup configure --ghc -v2 
--package-db=/var/lib/ghc/package.conf.d --prefix=/usr 
--libdir=/usr/lib/haskell-packages/ghc/lib --libexecdir=/usr/lib 
--builddir=dist-ghc --ghc-option=-optl-Wl\,-z\,relro 
--haddockdir=/usr/lib/ghc-doc/haddock/conduit-1.2.10/ --datasubdir=conduit 
--htmldir=/usr/share/doc/libghc-conduit-doc/html/ --enable-library-profiling 
--enable-tests
Configuring conduit-1.2.10...
hlibrary.setup: Encountered missing dependencies:
split >=0.2.0.0
/usr/share/cdbs/1/class/hlibrary.mk:142: recipe for target 
'configure-ghc-stamp' failed
make: *** [configure-ghc-stamp] Error 1
--- End Message ---
--- Begin Message ---
Source: haskell-conduit
Source-Version: 1.2.10-2

We believe that the bug you reported is fixed in the latest version of
haskell-conduit, which is due to be installed in the Debian FTP archive.

A summary of the changes between this version and the previous one is
attached.

Thank you for reporting the bug, which will now be closed.  If you
have further comments please address them to 865...@bugs.debian.org,
and the maintainer will reopen the bug report if appropriate.

Debian distribution maintenance software
pp.
Clint Adams  (supplier of updated haskell-conduit package)

(This message was generated automatically at their request; if you
believe that there is a problem with it please contact the archive
administrators by mailing ftpmas...@ftp-master.debian.org)


-BEGIN PGP SIGNED MESSAGE-
Hash: SHA512

Format: 1.8
Date: Sun, 18 Jun 2017 20:10:54 -0400
Source: haskell-conduit
Binary: libghc-conduit-dev libghc-conduit-prof libghc-conduit-doc
Architecture: source
Version: 1.2.10-2
Distribution: unstable
Urgency: medium
Maintainer: Debian Haskell Group 

Changed-By: Clint Adams 
Description:
 libghc-conduit-dev - streaming data processing library${haskell:ShortBlurb}
 libghc-conduit-doc - streaming data processing library${haskell:ShortBlurb}
 libghc-conduit-prof - streaming data processing library${haskell:ShortBlurb}
Closes: 865016
Changes:
 haskell-conduit (1.2.10-2) unstable; urgency=medium
 .
   * Fix build dependencies.  closes: #865016.
Checksums-Sha1:
 7fc4b6295bcf4200ad06cf10a6602b2ebff673dd 3155 haskell-conduit_1.2.10-2.dsc
 77203648a339ba57ee165ada3df5e071d65f0b92 58266 
haskell-conduit_1.2.10.orig.tar.gz
 2993098be6355c88e490b5c34febe178c738a411 3276 
haskell-conduit_1.2.10-2.debian.tar.xz
 2d5943b29c6f17b0cb03758bda732a25c18d624c 8027 
haskell-conduit_1.2.10-2_source.buildinfo
Checksums-Sha256:
 00d83392b74a16e26227048190273586cfff473d5e907ed5b7807f8baa39fb93 3155 
haskell-conduit_1.2.10-2.dsc
 d1167adea7da849a2636418926006546dce4cbde5ba324ade83416a691be58dd 58266 
haskell-conduit_1.2.10.orig.tar.gz
 7d5d895d3be66fddb76d9e98685b051461043713a5902ff7126ca16146adf99d 3276 
haskell-conduit_1.2.10-2.debian.tar.xz
 d6e38572d427491d9daa0aa933e2f768f0c0641b667802f9d49d0c762ea53553 8027 
haskell-conduit_1.2.10-2_source.buildinfo
Files:
 2417402af123188f9495eb4bedf81c63 3155 haskell extra 
haskell-conduit_1.2.10-2.dsc
 7d2aad4bddb0cab3c8c4edcadb098ee0 58266 haskell extra 
haskell-conduit_1.2.10.orig.tar.gz
 92e6fba6bd703537f109b29653351719 3276 haskell extra 
haskell-conduit_1.2.10-2.debian.tar.xz
 101fdcfa686ba46be23d7fceac1d74f9 8027 haskell extra 
haskell-conduit_1.2.10-2_source.buildinfo

-BEGIN PGP SIGNATURE-
Comment: Debian!

iQKlBAEBCgCPFiEEdYHsh0BT5sgHeRubVZIzHhmdOKgFAllHFq9fFIAALgAo
aXNzdWVyLWZwckBub3RhdGlvbnMub3BlbnBncC5maWZ0aGhvcnNlbWFuLm5ldDc1
ODFFQzg3NDA1M0U2QzgwNzc5MUI5QjU1OTIzMzFFMTk5RDM4QTgRHGNsaW50QGRl
Ymlhbi5vcmcACgkQVZIzHhmdOKgaNQ//f+uaTLYiTOk0NcPgHnnCVqscP7P9po/B

Bug#865062: marked as done (haskell-sockets: FTBFS due to missing B-D on libghc-sha-dev/prof)

[Debian Bug Tracking System]

Your message dated Mon, 19 Jun 2017 00:52:01 +
with message-id 
and subject line Bug#865062: fixed in haskell-websockets 0.9.8.2-2
has caused the Debian Bug report #865062,
regarding haskell-sockets: FTBFS due to missing B-D on libghc-sha-dev/prof
to be marked as done.

This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.

(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)


-- 
865062: http://bugs.debian.org/cgi-bin/bugreport.cgi?bug=865062
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---
Source: haskell-websockets
Version: 0.9.8.2-1
Severity: serious

Hi,
It seems the B-D on libghc-sha-dev got dropped when importing the new
upstream version; it's still needed:

> hlibrary.setup: Encountered missing dependencies:
> SHA >=1.5 && <1.7
> /usr/share/cdbs/1/class/hlibrary.mk:142: recipe for target 
> 'configure-ghc-stamp' failed

Regards,
James
--- End Message ---
--- Begin Message ---
Source: haskell-websockets
Source-Version: 0.9.8.2-2

We believe that the bug you reported is fixed in the latest version of
haskell-websockets, which is due to be installed in the Debian FTP archive.

A summary of the changes between this version and the previous one is
attached.

Thank you for reporting the bug, which will now be closed.  If you
have further comments please address them to 865...@bugs.debian.org,
and the maintainer will reopen the bug report if appropriate.

Debian distribution maintenance software
pp.
Clint Adams  (supplier of updated haskell-websockets package)

(This message was generated automatically at their request; if you
believe that there is a problem with it please contact the archive
administrators by mailing ftpmas...@ftp-master.debian.org)


-BEGIN PGP SIGNED MESSAGE-
Hash: SHA512

Format: 1.8
Date: Sun, 18 Jun 2017 20:27:17 -0400
Source: haskell-websockets
Binary: libghc-websockets-dev libghc-websockets-prof libghc-websockets-doc
Architecture: source
Version: 0.9.8.2-2
Distribution: unstable
Urgency: medium
Maintainer: Debian Haskell Group 

Changed-By: Clint Adams 
Description:
 libghc-websockets-dev - ${haskell:ShortDescription}${haskell:ShortBlurb}
 libghc-websockets-doc - ${haskell:ShortDescription}${haskell:ShortBlurb}
 libghc-websockets-prof - ${haskell:ShortDescription}${haskell:ShortBlurb}
Closes: 865062
Changes:
 haskell-websockets (0.9.8.2-2) unstable; urgency=medium
 .
   * Fix build dependencies.  closes: #865062.
Checksums-Sha1:
 de902007f99739e08fbc749c60880cc8d93106a7 4220 haskell-websockets_0.9.8.2-2.dsc
 39000c72fbc6c82ac290c51e510c0e5822b09669 23668 
haskell-websockets_0.9.8.2.orig.tar.gz
 92c0c5d5f71e8c98b10d8d08069b2657c90641db 3088 
haskell-websockets_0.9.8.2-2.debian.tar.xz
 49ff7b5e157927b0ee65809ef0631da60602d3ba 8434 
haskell-websockets_0.9.8.2-2_source.buildinfo
Checksums-Sha256:
 d3e6ba62370f8cd29ceb003f37d7ec5dd2c773f79ed40c320ebb155e90869dd2 4220 
haskell-websockets_0.9.8.2-2.dsc
 09ec17dfbf9f07da27575ce7853b0c80d87ad959c2b271f27be4c4e54615eca2 23668 
haskell-websockets_0.9.8.2.orig.tar.gz
 0d346171691fb6f67b3dfeb948998aaec7989ed024edae7216f897e7dc012a6e 3088 
haskell-websockets_0.9.8.2-2.debian.tar.xz
 f3124456dca417b7e529888c1ffe30569310e15e5fe2b0fad97ebcf689c4256e 8434 
haskell-websockets_0.9.8.2-2_source.buildinfo
Files:
 91fc6d1ff47e7349c2b4338e5d265ba8 4220 haskell extra 
haskell-websockets_0.9.8.2-2.dsc
 ec5d281d34161e2dc8d9f3a92df06087 23668 haskell extra 
haskell-websockets_0.9.8.2.orig.tar.gz
 625e4593b3ad485903cf92996a108d2c 3088 haskell extra 
haskell-websockets_0.9.8.2-2.debian.tar.xz
 65233779d29e7af5898eb0395c5a00c3 8434 haskell extra 
haskell-websockets_0.9.8.2-2_source.buildinfo

-BEGIN PGP SIGNATURE-
Comment: Debian!

iQKlBAEBCgCPFiEEdYHsh0BT5sgHeRubVZIzHhmdOKgFAllHGr1fFIAALgAo
aXNzdWVyLWZwckBub3RhdGlvbnMub3BlbnBncC5maWZ0aGhvcnNlbWFuLm5ldDc1
ODFFQzg3NDA1M0U2QzgwNzc5MUI5QjU1OTIzMzFFMTk5RDM4QTgRHGNsaW50QGRl
Ymlhbi5vcmcACgkQVZIzHhmdOKg3ew//ZB0kjkIt6l7ecpQucB+MV8kMg+zc+ord
LBFQv77A8v85dUGmpI/BIi1VH5fPPYhhkOdLYBFXjxi29zCGSwnJ2rPYix85t/O3
H0Vc6BdbE9b8TZXjsUSzp8mzDNuZ8vPlvye+4x3ytNeeyn55GW7hG9GhfoGpq/Cf
J2fRKXJSiQRz7slfdLinr09BdNcDwoA0UrrF9jg6YcmO8oh7VjHGJAii7mZPOeQf
SLWM+Y4TeVlYhYPskOIvNd51muJviUYKvLdZDmVLtypPOnK86+aIWGoQY/EcNI8U
lMCWi306KAo5SIuG2TseaoDT7x1TQg9/AlGwhssBDtoL37EuX4jLMbtaeMn5dBjP
i5jXWOQTutUYmIsH9kHAHspGASuUfykDBFw32VPhuaIED88j7bsfTvTK0IOyGaef
kyt2VioNvFJgTeTISGwL6m7WRzvbfCjFviMzfTKBGec+unG4/Ho6NU6p5qLO4dKi
iRuO70dPCt7M/22i3SAPh2kw0j3ctiQVppVJPV9plW0yJMN8cpwzgEPLxcLjlt7c
urPqWHa/zhIw1aoX3Qtr3/UnCL4pSwzqWm9iXRyl7MKey2sB1x2PmOK9LpiCFzge

Bug#865031: marked as done (haskell-pqueue FTBFS: Encountered missing dependencies: QuickCheck >=2.5 && <3)

[Debian Bug Tracking System]

Your message dated Mon, 19 Jun 2017 00:51:10 +
with message-id 
and subject line Bug#865031: fixed in haskell-pqueue 1.3.2.2-2
has caused the Debian Bug report #865031,
regarding haskell-pqueue FTBFS: Encountered missing dependencies: QuickCheck 
>=2.5 && <3
to be marked as done.

This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.

(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)


-- 
865031: http://bugs.debian.org/cgi-bin/bugreport.cgi?bug=865031
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---
Source: haskell-pqueue
Version: 1.3.2.2-1
Severity: serious

https://buildd.debian.org/status/package.php?p=haskell-pqueue=sid

...
   dh_auto_configure -a -O--buildsystem=haskell
ghc --make -threaded Setup.lhs -o debian/haskellbuild.setup
[1 of 1] Compiling Main ( Setup.lhs, Setup.o )
Linking debian/haskellbuild.setup ...
debian/haskellbuild.setup configure --builddir=dist-ghc --ghc -v2 
--package-db=/var/lib/ghc/package.conf.d --prefix=/usr 
--libdir=/usr/lib/haskell-packages/ghc/lib --datadir=/usr/share 
--ghc-option=-optl-Wl,-z,relro 
--haddockdir=/usr/lib/ghc-doc/haddock/pqueue-1.3.2.2/ --datasubdir=pqueue 
--htmldir=/usr/share/doc/libghc-pqueue-doc/html/ --enable-library-profiling 
--enable-tests
Configuring pqueue-1.3.2.2...
haskellbuild.setup: Encountered missing dependencies:
QuickCheck >=2.5 && <3
dh_auto_configure: debian/haskellbuild.setup configure --builddir=dist-ghc 
--ghc -v2 --package-db=/var/lib/ghc/package.conf.d --prefix=/usr 
--libdir=/usr/lib/haskell-packages/ghc/lib --datadir=/usr/share 
--ghc-option=-optl-Wl,-z,relro 
--haddockdir=/usr/lib/ghc-doc/haddock/pqueue-1.3.2.2/ --datasubdir=pqueue 
--htmldir=/usr/share/doc/libghc-pqueue-doc/html/ --enable-library-profiling 
--enable-tests returned exit code 1
debian/rules:4: recipe for target 'build-arch' failed
make: *** [build-arch] Error 1
--- End Message ---
--- Begin Message ---
Source: haskell-pqueue
Source-Version: 1.3.2.2-2

We believe that the bug you reported is fixed in the latest version of
haskell-pqueue, which is due to be installed in the Debian FTP archive.

A summary of the changes between this version and the previous one is
attached.

Thank you for reporting the bug, which will now be closed.  If you
have further comments please address them to 865...@bugs.debian.org,
and the maintainer will reopen the bug report if appropriate.

Debian distribution maintenance software
pp.
Clint Adams  (supplier of updated haskell-pqueue package)

(This message was generated automatically at their request; if you
believe that there is a problem with it please contact the archive
administrators by mailing ftpmas...@ftp-master.debian.org)


-BEGIN PGP SIGNED MESSAGE-
Hash: SHA512

Format: 1.8
Date: Sun, 18 Jun 2017 20:16:53 -0400
Source: haskell-pqueue
Binary: libghc-pqueue-dev libghc-pqueue-prof libghc-pqueue-doc
Architecture: source
Version: 1.3.2.2-2
Distribution: unstable
Urgency: medium
Maintainer: Debian Haskell Group 

Changed-By: Clint Adams 
Description:
 libghc-pqueue-dev - ${haskell:ShortDescription}${haskell:ShortBlurb}
 libghc-pqueue-doc - ${haskell:ShortDescription}${haskell:ShortBlurb}
 libghc-pqueue-prof - ${haskell:ShortDescription}${haskell:ShortBlurb}
Closes: 865031
Changes:
 haskell-pqueue (1.3.2.2-2) unstable; urgency=medium
 .
   * Fix build dependencies.  closes: #865031.
Checksums-Sha1:
 13b72a5b8297dad5bae031818b473a50caf7d1cb 2527 haskell-pqueue_1.3.2.2-2.dsc
 1223c6b5efe6a0be52b0685f214f8d0961cf770a 24405 
haskell-pqueue_1.3.2.2.orig.tar.gz
 b52738ac730bd8f046fda64bd0d36432b9afa255 2420 
haskell-pqueue_1.3.2.2-2.debian.tar.xz
 696ee52ecbe4dd77597678de9c210707b1354032 6909 
haskell-pqueue_1.3.2.2-2_source.buildinfo
Checksums-Sha256:
 7b9450f0adb6713c27fc80e89bdc49c7c70d8358ef11573a4c46a30692be99d5 2527 
haskell-pqueue_1.3.2.2-2.dsc
 27b5b57945325c0fb8b8447178ae27bfe243174da2d9b1ad38639e450b515035 24405 
haskell-pqueue_1.3.2.2.orig.tar.gz
 b23edae409cebf3911f616d43cfc081dad998c149d4330407564d4f467133d77 2420 
haskell-pqueue_1.3.2.2-2.debian.tar.xz
 55a6dad600eb8ba92b881335194e8e9b13acf7f59d9b81ef346b4d0413ddb58f 6909 
haskell-pqueue_1.3.2.2-2_source.buildinfo
Files:
 b5f0e6c7e53e7ed764d382ba5b36fc5d 2527 haskell extra 
haskell-pqueue_1.3.2.2-2.dsc
 7bcaa461614bea9586c2c514b4e28e5d 24405 haskell extra 
haskell-pqueue_1.3.2.2.orig.tar.gz
 fbdd3adc56d5781117a0649a46fcd43a 2420 haskell extra 
haskell-pqueue_1.3.2.2-2.debian.tar.xz
 b776eec0f386b9bf33101aae30969ad9 6909 haskell extra 
haskell-pqueue_1.3.2.2-2_source.buildinfo

Bug#865017: marked as done (haskell-hinotify FTBFS: hlibrary.setup: Encountered missing dependencies: async >=1.0 && <2.2)

[Debian Bug Tracking System]

Your message dated Mon, 19 Jun 2017 00:51:04 +
with message-id 
and subject line Bug#865017: fixed in haskell-hinotify 0.3.9-2
has caused the Debian Bug report #865017,
regarding haskell-hinotify FTBFS: hlibrary.setup: Encountered missing 
dependencies: async >=1.0 && <2.2
to be marked as done.

This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.

(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)


-- 
865017: http://bugs.debian.org/cgi-bin/bugreport.cgi?bug=865017
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---
Source: haskell-hinotify
Version: 0.3.9-1
Severity: serious

https://buildd.debian.org/status/package.php?p=haskell-hinotify=sid

...
make_setup_recipe
Running ghc --make Setup.lhs -o debian/hlibrary.setup
[1 of 1] Compiling Main ( Setup.lhs, Setup.o )
Linking debian/hlibrary.setup ...
. /usr/share/haskell-devscripts/Dh_Haskell.sh && \
configure_recipe
Running debian/hlibrary.setup configure --ghc -v2 
--package-db=/var/lib/ghc/package.conf.d --prefix=/usr 
--libdir=/usr/lib/haskell-packages/ghc/lib --libexecdir=/usr/lib 
--builddir=dist-ghc --ghc-option=-optl-Wl\,-z\,relro 
--haddockdir=/usr/lib/ghc-doc/haddock/hinotify-0.3.9/ --datasubdir=hinotify 
--htmldir=/usr/share/doc/libghc-hinotify-doc/html/ --enable-library-profiling
Configuring hinotify-0.3.9...
hlibrary.setup: Encountered missing dependencies:
async >=1.0 && <2.2
/usr/share/cdbs/1/class/hlibrary.mk:142: recipe for target 
'configure-ghc-stamp' failed
make: *** [configure-ghc-stamp] Error 1
--- End Message ---
--- Begin Message ---
Source: haskell-hinotify
Source-Version: 0.3.9-2

We believe that the bug you reported is fixed in the latest version of
haskell-hinotify, which is due to be installed in the Debian FTP archive.

A summary of the changes between this version and the previous one is
attached.

Thank you for reporting the bug, which will now be closed.  If you
have further comments please address them to 865...@bugs.debian.org,
and the maintainer will reopen the bug report if appropriate.

Debian distribution maintenance software
pp.
Clint Adams  (supplier of updated haskell-hinotify package)

(This message was generated automatically at their request; if you
believe that there is a problem with it please contact the archive
administrators by mailing ftpmas...@ftp-master.debian.org)


-BEGIN PGP SIGNED MESSAGE-
Hash: SHA512

Format: 1.8
Date: Sun, 18 Jun 2017 20:13:10 -0400
Source: haskell-hinotify
Binary: libghc-hinotify-dev libghc-hinotify-prof libghc-hinotify-doc
Architecture: source
Version: 0.3.9-2
Distribution: unstable
Urgency: medium
Maintainer: Debian Haskell Group 

Changed-By: Clint Adams 
Description:
 libghc-hinotify-dev - Haskell inotify library${haskell:ShortBlurb}
 libghc-hinotify-doc - Haskell inotify library${haskell:ShortBlurb}
 libghc-hinotify-prof - Haskell inotify library${haskell:ShortBlurb}
Closes: 865017
Changes:
 haskell-hinotify (0.3.9-2) unstable; urgency=medium
 .
   * Fix build dependencies.  closes: #865017.
Checksums-Sha1:
 0e6f5ba879c9a6f8e6c970542e377e58a8941007 2646 haskell-hinotify_0.3.9-2.dsc
 809950f3fe353d054588a7737b553f70d9192b31 9021 
haskell-hinotify_0.3.9.orig.tar.gz
 75deff426723f5c6c28122daf36521969396c449 3056 
haskell-hinotify_0.3.9-2.debian.tar.xz
 cbbf6947b1de9f9f637726472dd6b438d7a6a40e 6895 
haskell-hinotify_0.3.9-2_source.buildinfo
Checksums-Sha256:
 94ce6096fa9f88240c8731499dbb5c3629f995d585e4c4aa12ceb9839cc84588 2646 
haskell-hinotify_0.3.9-2.dsc
 f2480e4c08a516831c2221eebc6a9d3242e892932d9315c34cbe92a101c5df99 9021 
haskell-hinotify_0.3.9.orig.tar.gz
 4d93a3a743c72130b10b4ed8430bfc4dbde73b7cfb478c4b43e0a43af6546e29 3056 
haskell-hinotify_0.3.9-2.debian.tar.xz
 10e4a7d684f29c5833772141bcb16e6d34af52a7159800518681b75d053b6c2e 6895 
haskell-hinotify_0.3.9-2_source.buildinfo
Files:
 1a5ea0aaa48f3ac522c9529b6dcbf67f 2646 haskell extra 
haskell-hinotify_0.3.9-2.dsc
 4ab6bf8f23a5cd152fcaf17a1004f8c5 9021 haskell extra 
haskell-hinotify_0.3.9.orig.tar.gz
 0de7d367933c65e48297069ee0dfdcfb 3056 haskell extra 
haskell-hinotify_0.3.9-2.debian.tar.xz
 3fe0cccf2c8ff84ca4c46068a5dcad67 6895 haskell extra 
haskell-hinotify_0.3.9-2_source.buildinfo

-BEGIN PGP SIGNATURE-
Comment: Debian!

iQKlBAEBCgCPFiEEdYHsh0BT5sgHeRubVZIzHhmdOKgFAllHF3JfFIAALgAo
aXNzdWVyLWZwckBub3RhdGlvbnMub3BlbnBncC5maWZ0aGhvcnNlbWFuLm5ldDc1
ODFFQzg3NDA1M0U2QzgwNzc5MUI5QjU1OTIzMzFFMTk5RDM4QTgRHGNsaW50QGRl
Ymlhbi5vcmcACgkQVZIzHhmdOKghoA//ZEMib3ED3k3TpeAtqkMt2ZAB7j/cIkle

Bug#865038: marked as done (haskell-snap-core FTBFS: Encountered missing dependencies: HUnit >=1.2 && <2)

[Debian Bug Tracking System]

Your message dated Mon, 19 Jun 2017 00:51:22 +
with message-id 
and subject line Bug#865038: fixed in haskell-snap-core 1.0.2.1-2
has caused the Debian Bug report #865038,
regarding haskell-snap-core FTBFS: Encountered missing dependencies: HUnit 
>=1.2 && <2
to be marked as done.

This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.

(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)


-- 
865038: http://bugs.debian.org/cgi-bin/bugreport.cgi?bug=865038
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---
Source: haskell-snap-core
Version: 1.0.2.1-1
Severity: serious

https://buildd.debian.org/status/package.php?p=haskell-snap-core=sid

...
make_setup_recipe
Running ghc --make Setup.hs -o debian/hlibrary.setup
[1 of 1] Compiling Main ( Setup.hs, Setup.o )
Linking debian/hlibrary.setup ...
. /usr/share/haskell-devscripts/Dh_Haskell.sh && \
configure_recipe
Running debian/hlibrary.setup configure --ghc -v2 
--package-db=/var/lib/ghc/package.conf.d --prefix=/usr 
--libdir=/usr/lib/haskell-packages/ghc/lib --libexecdir=/usr/lib 
--builddir=dist-ghc --ghc-option=-optl-Wl\,-z\,relro 
--haddockdir=/usr/lib/ghc-doc/haddock/snap-core-1.0.2.1/ --datasubdir=snap-core 
--htmldir=/usr/share/doc/libghc-snap-core-doc/html/ --enable-library-profiling
Configuring snap-core-1.0.2.1...
hlibrary.setup: Encountered missing dependencies:
HUnit >=1.2 && <2
/usr/share/cdbs/1/class/hlibrary.mk:142: recipe for target 
'configure-ghc-stamp' failed
make: *** [configure-ghc-stamp] Error 1
--- End Message ---
--- Begin Message ---
Source: haskell-snap-core
Source-Version: 1.0.2.1-2

We believe that the bug you reported is fixed in the latest version of
haskell-snap-core, which is due to be installed in the Debian FTP archive.

A summary of the changes between this version and the previous one is
attached.

Thank you for reporting the bug, which will now be closed.  If you
have further comments please address them to 865...@bugs.debian.org,
and the maintainer will reopen the bug report if appropriate.

Debian distribution maintenance software
pp.
Clint Adams  (supplier of updated haskell-snap-core package)

(This message was generated automatically at their request; if you
believe that there is a problem with it please contact the archive
administrators by mailing ftpmas...@ftp-master.debian.org)


-BEGIN PGP SIGNED MESSAGE-
Hash: SHA512

Format: 1.8
Date: Sun, 18 Jun 2017 20:22:35 -0400
Source: haskell-snap-core
Binary: libghc-snap-core-dev libghc-snap-core-prof libghc-snap-core-doc
Architecture: source
Version: 1.0.2.1-2
Distribution: unstable
Urgency: medium
Maintainer: Debian Haskell Group 

Changed-By: Clint Adams 
Description:
 libghc-snap-core-dev - Snap: A Haskell Web Framework (Core)
 libghc-snap-core-doc - Snap: A Haskell Web Framework (Core); documentation
 libghc-snap-core-prof - Snap: A Haskell Web Framework (Core); profiling 
libraries
Closes: 865038
Changes:
 haskell-snap-core (1.0.2.1-2) unstable; urgency=medium
 .
   * Fix build dependencies.  closes: #865038.
Checksums-Sha1:
 50158c28154002889335845241e21dbd3217fe4e 5809 haskell-snap-core_1.0.2.1-2.dsc
 5aa8e73f57d42144c859f5f92f0eef37780ddf44 142939 
haskell-snap-core_1.0.2.1.orig.tar.gz
 c51ac023d37d7866f28c4369e318b491ad888da4 4408 
haskell-snap-core_1.0.2.1-2.debian.tar.xz
 eb9e84474dc27c3ed651e3d254f96f7be3927859 9430 
haskell-snap-core_1.0.2.1-2_source.buildinfo
Checksums-Sha256:
 0c1cde0884420a5e76bd0d1d7194f44427cc2b8ef817a2ae88ebb26ab09516ee 5809 
haskell-snap-core_1.0.2.1-2.dsc
 de903d5dc4640f49cfebb41b4442f4901057a8627694373639d3972ccdcca11d 142939 
haskell-snap-core_1.0.2.1.orig.tar.gz
 64645df3362f15ed8bdb788b7237bb67824971e94efb931e6719826292857ff8 4408 
haskell-snap-core_1.0.2.1-2.debian.tar.xz
 921f39d93eefcde800657c5151cbcec8a9f6a341ed848f6d52156fc033c9c46d 9430 
haskell-snap-core_1.0.2.1-2_source.buildinfo
Files:
 7e701cf48872d59e00b86ae46dc26b63 5809 haskell extra 
haskell-snap-core_1.0.2.1-2.dsc
 e9fe7c37aa0a0878cc546badb02936d7 142939 haskell extra 
haskell-snap-core_1.0.2.1.orig.tar.gz
 7f9968cb4b27a93801a0e984bfc74c4a 4408 haskell extra 
haskell-snap-core_1.0.2.1-2.debian.tar.xz
 b3774dc5032b28a9616050ffdc3c73dd 9430 haskell extra 
haskell-snap-core_1.0.2.1-2_source.buildinfo

-BEGIN PGP SIGNATURE-
Comment: Debian!

iQKlBAEBCgCPFiEEdYHsh0BT5sgHeRubVZIzHhmdOKgFAllHGbdfFIAALgAo
aXNzdWVyLWZwckBub3RhdGlvbnMub3BlbnBncC5maWZ0aGhvcnNlbWFuLm5ldDc1
ODFFQzg3NDA1M0U2QzgwNzc5MUI5QjU1OTIzMzFFMTk5RDM4QTgRHGNsaW50QGRl

Processed: Re: [Debian-med-packaging] Bug#865039: libhat-trie FTBFS on 32bit: check_ahtable fails

[Debian Bug Tracking System]

Processing commands for cont...@bugs.debian.org:

> forwarded 865039 https://github.com/dcjones/hat-trie/issues/31
Bug #865039 [src:libhat-trie] libhat-trie FTBFS on 32bit: check_ahtable fails
Set Bug forwarded-to-address to 'https://github.com/dcjones/hat-trie/issues/31'.
> tags 865039 upstream
Bug #865039 [src:libhat-trie] libhat-trie FTBFS on 32bit: check_ahtable fails
Added tag(s) upstream.
> thanks
Stopping processing here.

Please contact me if you need assistance.
-- 
865039: http://bugs.debian.org/cgi-bin/bugreport.cgi?bug=865039
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems

Bug#865039: [Debian-med-packaging] Bug#865039: libhat-trie FTBFS on 32bit: check_ahtable fails

[Sascha Steinbiss]

forwarded 865039 https://github.com/dcjones/hat-trie/issues/31
tags 865039 upstream
thanks

> On 18 Jun 2017, at 21:56, Adrian Bunk  wrote:
> 
> Source: libhat-trie
> Version: 0.1.1-1
> Severity: serious
> 
> https://buildd.debian.org/status/package.php?p=libhat-trie
> 
> ...
> make  check-TESTS
> make[3]: Entering directory '/«PKGBUILDDIR»/test'
> make[4]: Entering directory '/«PKGBUILDDIR»/test'
> ../test-driver: line 107: 10255 Segmentation fault  "$@" > $log_file 2>&1

Thanks for your report, I could reproduce this — actually I already filed a bug 
upstream in the end of April. Let’s see what they say, I just sent a followup.

Kind regards
Sascha



signature.asc
Description: Message signed with OpenPGP

Processed: Re: Bug#865015: debian-installer: Live installers are unable to start, "There was a problem reading data from the CD-ROM"

[Debian Bug Tracking System]

Processing control commands:

> reassign -1 live-installer
Bug #865015 [debian-installer] debian-installer: Live installers are unable to 
start, "There was a problem reading data from the CD-ROM"
Bug reassigned from package 'debian-installer' to 'live-installer'.
Ignoring request to alter found versions of bug #865015 to the same values 
previously set
Ignoring request to alter fixed versions of bug #865015 to the same values 
previously set

-- 
865015: http://bugs.debian.org/cgi-bin/bugreport.cgi?bug=865015
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems

Bug#865015: debian-installer: Live installers are unable to start, "There was a problem reading data from the CD-ROM"

[Cyril Brulebois]

Control: reassign -1 live-installer

Francisco Gómez  (2017-06-18):
> Package: debian-installer
> Severity: grave
> Justification: renders package unusable
> 
> When trying to install Debian, the installer is unable to start, and the
> following error appears:
> 
> "There was an error reading data from the CD-ROM. Please make sure it is in 
> the
> drive. If retrying does not work, you should check the integrity of your CD-
> ROM."
> 
> Retrying does not solve the problem. On the console, with an AMD64 image, the
> following output is displayed:
> 
> cdrom-retriever: error: Unable to find
> `/w/work/free/gnomepool/main/libl/libzlo2-2-udeb/libzlo2-2-udeb_2.08-1.2+b2_amd64.udeb`
> 
> This has been tested with the live image "debian-9.0.0-amd64-i386-netinst.iso"
> on multiple machines by multiple people, including on my iMac via Virtualbox,
> downloaded from torrent.

This seems to have been independently discovered by Steve (“the Packages
files in the image point to .debs using full path, not relative to the
stuff in the image”). Reassigning to live-installer, which might not be
the correct package, but is probably better than just debian-installer.


KiBi.


signature.asc
Description: Digital signature

Processed: Re: Bug#865015: debian-installer: Live installers are unable to start, "There was a problem reading data from the CD-ROM"

[Debian Bug Tracking System]

Processing control commands:

> reassign -1 live-installer
Bug #865015 [live-installer] debian-installer: Live installers are unable to 
start, "There was a problem reading data from the CD-ROM"
Ignoring request to reassign bug #865015 to the same package

-- 
865015: http://bugs.debian.org/cgi-bin/bugreport.cgi?bug=865015
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems

Bug#864974: thunderbird: Missing AtomicOperations for multiple architectures cause FTBFS

[John Paul Adrian Glaubitz]

On 06/18/2017 10:48 AM, John Paul Adrian Glaubitz wrote:
> On 06/18/2017 10:40 AM, John Paul Adrian Glaubitz wrote:
>> powerpc and powerpcspe: __ppc__
> 
> Correction: powerpc and powerpcspe should actually be covered:

Hmm, looks like I was mislead by the gitweb view. Looking at the
source, AtomicOperations-ppc.h is included for everything but
s390x.

So, it's safe to assume it FTBFS on s390x because of the missing
atomic operations. No idea about the other architectures though,
it should definitely work.

Adrian

-- 
 .''`.  John Paul Adrian Glaubitz
: :' :  Debian Developer - glaub...@debian.org
`. `'   Freie Universitaet Berlin - glaub...@physik.fu-berlin.de
  `-GPG: 62FF 8A75 84E0 2956 9546  0006 7426 3B37 F5B5 F913

Bug#865060: bcftools FTBFS: Usage: test-regidx [OPTIONS]

[Adrian Bunk]

Source: bcftools
Version: 1.4.1-1
Severity: serious

https://buildd.debian.org/status/package.php?p=bcftools=sid

...
make[1]: Leaving directory '/«PKGBUILDDIR»'
   dh_auto_test -a -O--parallel
make -j6 test
make[1]: Entering directory '/«PKGBUILDDIR»'
./test/test-regidx
Usage: test-regidx [OPTIONS]
Options:
   -h, --help  this help message
   -s, --seed random seed
   -v, --verbose   increase verbosity by giving multiple times
Makefile:121: recipe for target 'test' failed
make[1]: *** [test] Error 1
make[1]: Leaving directory '/«PKGBUILDDIR»'
dh_auto_test: make -j6 test returned exit code 2
debian/rules:11: recipe for target 'build-arch' failed
make: *** [build-arch] Error 2

Bug#865038: haskell-snap-core FTBFS: Encountered missing dependencies: HUnit >=1.2 && <2

[Adrian Bunk]

Source: haskell-snap-core
Version: 1.0.2.1-1
Severity: serious

https://buildd.debian.org/status/package.php?p=haskell-snap-core=sid

...
make_setup_recipe
Running ghc --make Setup.hs -o debian/hlibrary.setup
[1 of 1] Compiling Main ( Setup.hs, Setup.o )
Linking debian/hlibrary.setup ...
. /usr/share/haskell-devscripts/Dh_Haskell.sh && \
configure_recipe
Running debian/hlibrary.setup configure --ghc -v2 
--package-db=/var/lib/ghc/package.conf.d --prefix=/usr 
--libdir=/usr/lib/haskell-packages/ghc/lib --libexecdir=/usr/lib 
--builddir=dist-ghc --ghc-option=-optl-Wl\,-z\,relro 
--haddockdir=/usr/lib/ghc-doc/haddock/snap-core-1.0.2.1/ --datasubdir=snap-core 
--htmldir=/usr/share/doc/libghc-snap-core-doc/html/ --enable-library-profiling
Configuring snap-core-1.0.2.1...
hlibrary.setup: Encountered missing dependencies:
HUnit >=1.2 && <2
/usr/share/cdbs/1/class/hlibrary.mk:142: recipe for target 
'configure-ghc-stamp' failed
make: *** [configure-ghc-stamp] Error 1

Processed: Proper version tracking

[Debian Bug Tracking System]

Processing commands for cont...@bugs.debian.org:

> fixed 859111 2.9.2+ds-1
Bug #859111 {Done: Sascha Steinbiss } [src:ariba] ariba FTBFS 
with bowtie2 2.3.1-1
Marked as fixed in versions ariba/2.9.2+ds-1.
> thanks
Stopping processing here.

Please contact me if you need assistance.
-- 
859111: http://bugs.debian.org/cgi-bin/bugreport.cgi?bug=859111
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems

Processed: Add missing tags

[Debian Bug Tracking System]

Processing commands for cont...@bugs.debian.org:

> tags 865007 buster sid
Bug #865007 [src:libtabixpp] libtabixpp FTBFS with htslib 1.4.1-2: devlibs 
error: There is no package matching [libhts2-dev] and noone provides it
Added tag(s) sid and buster.
> thanks
Stopping processing here.

Please contact me if you need assistance.
-- 
865007: http://bugs.debian.org/cgi-bin/bugreport.cgi?bug=865007
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems

Bug#865012: htslib FTBFS on i386: test_vcf_{api,sweep} failed

[Adrian Bunk]

Source: htslib
Version: 1.4.1-2
Severity: serious

https://buildd.debian.org/status/fetch.php?pkg=htslib=i386=1.4.1-2=1497791395=0

...
test_vcf_api:
/«PKGBUILDDIR»/test/test-vcf-api /tmp/oeVTxGSQA_/test-vcf-api.bcf
bcf_get_format_float didn't produce the expected output.

.. failed ...

test_vcf_sweep:
/«PKGBUILDDIR»/test/test-vcf-sweep /tmp/oeVTxGSQA_/test-vcf-api.bcf

The outputs differ:
/«PKGBUILDDIR»/test/test-vcf-sweep.out
/«PKGBUILDDIR»/test/test-vcf-sweep.out.new
.. failed ...
...
Number of tests:
total   .. 84
passed  .. 82
failed  .. 2

Makefile:356: recipe for target 'test' failed
make[2]: *** [test] Error 1
make[2]: Leaving directory '/«PKGBUILDDIR»'
dh_auto_test: make -j4 test VERBOSE=1 returned exit code 2
debian/rules:13: recipe for target 'override_dh_auto_test' failed
make[1]: *** [override_dh_auto_test] Error 2

Bug#865017: haskell-hinotify FTBFS: hlibrary.setup: Encountered missing dependencies: async >=1.0 && <2.2

[Adrian Bunk]

Source: haskell-hinotify
Version: 0.3.9-1
Severity: serious

https://buildd.debian.org/status/package.php?p=haskell-hinotify=sid

...
make_setup_recipe
Running ghc --make Setup.lhs -o debian/hlibrary.setup
[1 of 1] Compiling Main ( Setup.lhs, Setup.o )
Linking debian/hlibrary.setup ...
. /usr/share/haskell-devscripts/Dh_Haskell.sh && \
configure_recipe
Running debian/hlibrary.setup configure --ghc -v2 
--package-db=/var/lib/ghc/package.conf.d --prefix=/usr 
--libdir=/usr/lib/haskell-packages/ghc/lib --libexecdir=/usr/lib 
--builddir=dist-ghc --ghc-option=-optl-Wl\,-z\,relro 
--haddockdir=/usr/lib/ghc-doc/haddock/hinotify-0.3.9/ --datasubdir=hinotify 
--htmldir=/usr/share/doc/libghc-hinotify-doc/html/ --enable-library-profiling
Configuring hinotify-0.3.9...
hlibrary.setup: Encountered missing dependencies:
async >=1.0 && <2.2
/usr/share/cdbs/1/class/hlibrary.mk:142: recipe for target 
'configure-ghc-stamp' failed
make: *** [configure-ghc-stamp] Error 1

Bug#859111: marked as done (ariba FTBFS with bowtie2 2.3.1-1)

[Debian Bug Tracking System]

Your message dated Sun, 18 Jun 2017 21:32:48 +0200
with message-id <77fce4b7-ab66-4428-864c-02cbfc535...@debian.org>
and subject line Re: [Debian-med-packaging] Bug#859111: Bug#859111: Bug#859111: 
ariba: FTBFS: FAIL: Test run_bowtie2 unsorted
has caused the Debian Bug report #859111,
regarding ariba FTBFS with bowtie2 2.3.1-1
to be marked as done.

This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.

(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)


-- 
859111: http://bugs.debian.org/cgi-bin/bugreport.cgi?bug=859111
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---
Source: ariba
Version: 2.7.1+ds-1
Severity: serious
Justification: fails to build from source
User: reproducible-bui...@lists.alioth.debian.org
Usertags: ftbfs
X-Debbugs-Cc: reproducible-b...@lists.alioth.debian.org

Dear Maintainer,

ariba fails to build from source in unstable/amd64:

  […]

  ==
  FAIL: Test run_bowtie2 unsorted
  --
  Traceback (most recent call last):
File "«BUILDDIR»/ariba/tests/mapping_test.py", line 61, in test_run_bowtie2
  self.assertListEqual(expected, got)
  AssertionError: Lists differ: [('1', 99, 'ref', 0, [(4, 5), (0, 20)], 
'AGCCCTC[857 chars]AT')] != [('1', 153, 'ref', 30, [(0, 25)], 
'AGGATACAGATCT[794 chars]AT')]
  
  First differing element 0:
  ('1', 99, 'ref', 0, [(4, 5), (0, 20)], 'AGCCCTCCACAGGATGGTGGTATAC')
  ('1', 153, 'ref', 30, [(0, 25)], 'AGGATACAGATCTTGTGGGAAAGGT')
  
  - [('1', 99, 'ref', 0, [(4, 5), (0, 20)], 'AGCCCTCCACAGGATGGTGGTATAC'),
  -  ('1', 147, 'ref', 30, [(0, 25)], 'AGGATACAGATCTTGTGGGAAAGGT'),
  ? ^   ^^
  
  + [('1', 153, 'ref', 30, [(0, 25)], 'AGGATACAGATCTTGTGGGAAAGGT'),
  ? ^   ^^
  
  +  ('1', 69, None, 30, [], 'AGCCCTCCACAGGATGGTGGTATAC'),
  -  ('2', 99, 'ref', 124, [(0, 25)], 'TAATGTTCTTAGGGCTTACCATAGA'),
  ?^^
  
  +  ('2', 73, 'ref', 124, [(0, 25)], 'TAATGTTCTTAGGGCTTACCATAGA'),
  ?^^
  
  -  ('2', 147, 'ref', 170, [(0, 20), (4, 5)], 'TCCACCTTAGCTAAGCGCAGACTCG'),
  +  ('2', 133, None, 124, [], 'CGAGTCTGCGCTTAGCTAAGGTGGA'),
 ('3', 73, 'ref', 86, [(0, 25)], 'TCGGGTCTGTACAAGGACGGATGGT'),
 ('3', 133, None, 86, [], 'CGTACTGACTGACTGACGTACTGCA'),
 ('4', 99, 'ref', 55, [(0, 25)], 'CCGCCGGGAAGTCCTTCTGTCGTGC'),
 ('4', 147, 'ref', 136, [(0, 25)], 'GGCTTACCATAGAGGTACACT'),
  -  ('5', 99, 'ref', 0, [(4, 2), (0, 23)], 'CCTCCACAGGATGGTGGTATACCTG'),
  ?^^  ^^ --  ^   ---
  
  +  ('5', 77, None, -1, [], 'CCTCCACAGGATGGTGGTATACCTG'),
  ?^^  ^^^   ^^
  
  -  ('5', 147, 'ref', 166, [(0, 24), (4, 1)], 'TTCATCCACCTTAGCTAAGCGCAGA'),
  +  ('5', 141, None, -1, [], 'TCTGCGCTTAGCTAAGGTGGATGAA'),
 ('6', 77, None, -1, [], 'CAGTTGCATGACGTCATGCAGTCAT'),
 ('6', 141, None, -1, [], 'AATGAGTATGATGAGTAATGGTATG'),
 ('7', 99, 'ref', 56, [(4, 1), (0, 23), (4, 1)], 
'ACGCCGGGAAGTCCTTCTGTCGTGT'),
 ('7', 147, 'ref', 136, [(0, 24), (4, 1)], 'GGCTTACCATAGAGGTACACTAAAT')]
  
  ==
  FAIL: Test run_bowtie2 sorted
  --
  Traceback (most recent call last):
File "«BUILDDIR»/ariba/tests/mapping_test.py", line 102, in 
test_run_bowtie2_and_sort
  self.assertListEqual(expected, got)
  AssertionError: Lists differ: [('1', 99, 'ref', 0, [(4, 5), (0, 20)], 
'AGCCCTC[857 chars]TG')] != [('1', 69, None, 30, [], 
'AGCCCTCCACAGGATGGTGGTA[794 chars]TG')]
  
  First differing element 0:
  ('1', 99, 'ref', 0, [(4, 5), (0, 20)], 'AGCCCTCCACAGGATGGTGGTATAC')
  ('1', 69, None, 30, [], 'AGCCCTCCACAGGATGGTGGTATAC')
  
  Diff is 1432 characters long. Set self.maxDiff to None to see it.
  
  --
  Ran 317 tests in 59.987s
  
  FAILED (failures=2)
  debian/rules:23: recipe for target 'override_dh_auto_test' failed
  make[1]: *** [override_dh_auto_test] Error 1
  make[1]: Leaving directory '«BUILDDIR»'
  debian/rules:10: recipe for target 'build' failed
  make: *** [build] Error 2
  dpkg-buildpackage: error: debian/rules build gave error exit status 2

  […]

The full build log is attached.


Regards,

-- 
  ,''`.
 : :'  : Chris Lamb
 `. `'`  la...@debian.org / chris-lamb.co.uk
   `-


ariba.2.7.1+ds-1.unstable.amd64.log.txt.gz
Description: Binary data
--- End Message ---
--- Begin Message ---
> Upstream have added support for Bowtie2 2.3.1 [1] and I can confirm that
> the tests -- and hence the build -- are fixed using this latest version.
> 

Bug#865031: haskell-pqueue FTBFS: Encountered missing dependencies: QuickCheck >=2.5 && <3

[Adrian Bunk]

Source: haskell-pqueue
Version: 1.3.2.2-1
Severity: serious

https://buildd.debian.org/status/package.php?p=haskell-pqueue=sid

...
   dh_auto_configure -a -O--buildsystem=haskell
ghc --make -threaded Setup.lhs -o debian/haskellbuild.setup
[1 of 1] Compiling Main ( Setup.lhs, Setup.o )
Linking debian/haskellbuild.setup ...
debian/haskellbuild.setup configure --builddir=dist-ghc --ghc -v2 
--package-db=/var/lib/ghc/package.conf.d --prefix=/usr 
--libdir=/usr/lib/haskell-packages/ghc/lib --datadir=/usr/share 
--ghc-option=-optl-Wl,-z,relro 
--haddockdir=/usr/lib/ghc-doc/haddock/pqueue-1.3.2.2/ --datasubdir=pqueue 
--htmldir=/usr/share/doc/libghc-pqueue-doc/html/ --enable-library-profiling 
--enable-tests
Configuring pqueue-1.3.2.2...
haskellbuild.setup: Encountered missing dependencies:
QuickCheck >=2.5 && <3
dh_auto_configure: debian/haskellbuild.setup configure --builddir=dist-ghc 
--ghc -v2 --package-db=/var/lib/ghc/package.conf.d --prefix=/usr 
--libdir=/usr/lib/haskell-packages/ghc/lib --datadir=/usr/share 
--ghc-option=-optl-Wl,-z,relro 
--haddockdir=/usr/lib/ghc-doc/haddock/pqueue-1.3.2.2/ --datasubdir=pqueue 
--htmldir=/usr/share/doc/libghc-pqueue-doc/html/ --enable-library-profiling 
--enable-tests returned exit code 1
debian/rules:4: recipe for target 'build-arch' failed
make: *** [build-arch] Error 1

Bug#865008: marked as done (samtools FTBFS with htslib 1.4.1-2: error: conflicting types for 'errmod_t')

[Debian Bug Tracking System]

Your message dated Sun, 18 Jun 2017 19:37:43 +
with message-id 
and subject line Bug#865008: fixed in samtools 1.4.1-1
has caused the Debian Bug report #865008,
regarding samtools FTBFS with htslib 1.4.1-2: error: conflicting types for 
'errmod_t'
to be marked as done.

This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.

(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)


-- 
865008: http://bugs.debian.org/cgi-bin/bugreport.cgi?bug=865008
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---
Source: samtools
Version: 1.3.1-3
Severity: serious
Tags: buster sid

https://tests.reproducible-builds.org/debian/rb-pkg/unstable/amd64/samtools.html
https://buildd.debian.org/status/fetch.php?pkg=samtools=mips=1.3.1-3=1497794431=0

...
gcc -g -O2 -fstack-protector-strong -Wformat -Werror=format-security -I.
-Wdate-time -D_FORTIFY_SOURCE=2 -c -o bam2bcf_indel.o bam2bcf_indel.c
In file included from bam2bcf.h:31:0,
 from bam2bcf_indel.c:32:
errmod.h:36:3: error: conflicting types for 'errmod_t'
 } errmod_t;
   ^~~~
In file included from /usr/include/htslib/sam.h:31:0,
 from bam2bcf_indel.c:31:
/usr/include/htslib/hts.h:659:25: note: previous declaration of 'errmod_t' was 
here
 typedef struct errmod_t errmod_t;
 ^~~~
...
--- End Message ---
--- Begin Message ---
Source: samtools
Source-Version: 1.4.1-1

We believe that the bug you reported is fixed in the latest version of
samtools, which is due to be installed in the Debian FTP archive.

A summary of the changes between this version and the previous one is
attached.

Thank you for reporting the bug, which will now be closed.  If you
have further comments please address them to 865...@bugs.debian.org,
and the maintainer will reopen the bug report if appropriate.

Debian distribution maintenance software
pp.
Andreas Tille  (supplier of updated samtools package)

(This message was generated automatically at their request; if you
believe that there is a problem with it please contact the archive
administrators by mailing ftpmas...@ftp-master.debian.org)


-BEGIN PGP SIGNED MESSAGE-
Hash: SHA256

Format: 1.8
Date: Sun, 18 Jun 2017 21:11:09 +0200
Source: samtools
Binary: samtools samtools-test
Architecture: source amd64 all
Version: 1.4.1-1
Distribution: unstable
Urgency: medium
Maintainer: Debian Med Packaging Team 

Changed-By: Andreas Tille 
Description:
 samtools   - processing sequence alignments in SAM and BAM formats
 samtools-test - test files for the samtools package
Closes: 865008
Changes:
 samtools (1.4.1-1) unstable; urgency=medium
 .
   * New upstream version
 Closes: #865008
Checksums-Sha1:
 4eded9efe285b1b813b98be8489076df883cc493 2232 samtools_1.4.1-1.dsc
 9434998ce15ea78e817842f8b7f6831fd08d7fdf 3988842 samtools_1.4.1.orig.tar.gz
 5396d0b2e0bc70975a718019e59d70d0fb7fc1a8 20824 samtools_1.4.1-1.debian.tar.xz
 d89d04432348f6dae2c3e375b6423f9b2fa2ee67 494734 
samtools-dbgsym_1.4.1-1_amd64.deb
 63cf45981f882108db65283439e0ac5e1f26f1c5 2011022 samtools-test_1.4.1-1_all.deb
 e4bda78849eaff076265b523f9352a470171ee8f 6834 samtools_1.4.1-1_amd64.buildinfo
 0b82ccb408eba9607a71d7794a40bbc1b5be8610 254016 samtools_1.4.1-1_amd64.deb
Checksums-Sha256:
 59399fa573e51c3b321cfcc430121364c1f7d0862355435220b75b202f63e2f5 2232 
samtools_1.4.1-1.dsc
 a0eece62194121884be4ed418b2137db7bb179d6410ed8071751e0eeec49b3b8 3988842 
samtools_1.4.1.orig.tar.gz
 846827d3e31483d3054f57eccc4161f4c69d32511acb7fdcadeae5519fc0b774 20824 
samtools_1.4.1-1.debian.tar.xz
 da8acd1edf4f8cb0553284ca36a92449304670dab9e397bb0fd76bf8b35564f8 494734 
samtools-dbgsym_1.4.1-1_amd64.deb
 1c9f872141fefb1510c31bcfb8c78f9bf097e61788ac37cd88217a1180f4a139 2011022 
samtools-test_1.4.1-1_all.deb
 7022160deb8596578878ae7903c25ca963815fbd1e881271709cbe51c8aadbf5 6834 
samtools_1.4.1-1_amd64.buildinfo
 7f109f1e6a2608bbbfb5adf5fabfc7d2dd5186f9247202336a75546028b6115b 254016 
samtools_1.4.1-1_amd64.deb
Files:
 d527237d276552358f56aadf8b930cee 2232 science optional samtools_1.4.1-1.dsc
 bceee04bad70a7fea1c56e61f84c7766 3988842 science optional 
samtools_1.4.1.orig.tar.gz
 77383229649ad754ab723b363d011eb1 20824 science optional 
samtools_1.4.1-1.debian.tar.xz
 23cb676bc67e9b2d6121ee190435f34d 494734 debug extra 
samtools-dbgsym_1.4.1-1_amd64.deb
 045ecc33315f6bfb67151a55bfb4e925 2011022 science optional 
samtools-test_1.4.1-1_all.deb
 549190e7a9737c2d5d80bb45eeb0dda9 6834 science optional 
samtools_1.4.1-1_amd64.buildinfo
 197522d47e6075827a2a55fa6a88e24e 254016 science optional 

Bug#865016: haskell-conduit FTBFS: hlibrary.setup: Encountered missing dependencies: split >=0.2.0.0

[Adrian Bunk]

Source: haskell-conduit
Version: 1.2.10-1
Severity: serious

https://buildd.debian.org/status/package.php?p=haskell-conduit=sid

...
make_setup_recipe
Running ghc --make Setup.lhs -o debian/hlibrary.setup
[1 of 1] Compiling Main ( Setup.lhs, Setup.o )
Linking debian/hlibrary.setup ...
. /usr/share/haskell-devscripts/Dh_Haskell.sh && \
configure_recipe
Running debian/hlibrary.setup configure --ghc -v2 
--package-db=/var/lib/ghc/package.conf.d --prefix=/usr 
--libdir=/usr/lib/haskell-packages/ghc/lib --libexecdir=/usr/lib 
--builddir=dist-ghc --ghc-option=-optl-Wl\,-z\,relro 
--haddockdir=/usr/lib/ghc-doc/haddock/conduit-1.2.10/ --datasubdir=conduit 
--htmldir=/usr/share/doc/libghc-conduit-doc/html/ --enable-library-profiling 
--enable-tests
Configuring conduit-1.2.10...
hlibrary.setup: Encountered missing dependencies:
split >=0.2.0.0
/usr/share/cdbs/1/class/hlibrary.mk:142: recipe for target 
'configure-ghc-stamp' failed
make: *** [configure-ghc-stamp] Error 1

Bug#865026: libusb.h: __linux usage makes ippusbxd FTBFS on ppc

[Adrian Bunk]

Package: libusb-1.0-0-dev
Version: 2:1.0.21-1
Severity: serious
Tags: patch buster sid
Control: affects -1 src:ippusbxd

https://buildd.debian.org/status/fetch.php?pkg=ippusbxd=ppc64el=1.30-2=1497806137=0

...
[ 50%] Building C object CMakeFiles/ippusbxd.dir/usb.c.o
/usr/bin/cc   -I/usr/include/libusb-1.0  -g -O2 
-fdebug-prefix-map=/«PKGBUILDDIR»=. -fstack-protector-strong -Wformat 
-Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -o2 -g -std=c99 -Wall 
-Wextra -pedantic -pedantic-errors   -o CMakeFiles/ippusbxd.dir/usb.c.o   -c 
/«PKGBUILDDIR»/src/usb.c
In file included from /«PKGBUILDDIR»/src/usb.c:23:0:
/usr/include/libusb-1.0/libusb.h:1815:67: warning: 'struct timeval' declared 
inside parameter list will not be visible outside of this definition or 
declaration
 int LIBUSB_CALL libusb_wait_for_event(libusb_context *ctx, struct timeval *tv);
   ^~~
/usr/include/libusb-1.0/libusb.h:1818:9: warning: 'struct timeval' declared 
inside parameter list will not be visible outside of this definition or 
declaration
  struct timeval *tv);
 ^~~
/usr/include/libusb-1.0/libusb.h:1820:9: warning: 'struct timeval' declared 
inside parameter list will not be visible outside of this definition or 
declaration
  struct timeval *tv, int *completed);
 ^~~
/usr/include/libusb-1.0/libusb.h:1824:9: warning: 'struct timeval' declared 
inside parameter list will not be visible outside of this definition or 
declaration
  struct timeval *tv);
 ^~~
/usr/include/libusb-1.0/libusb.h:1827:9: warning: 'struct timeval' declared 
inside parameter list will not be visible outside of this definition or 
declaration
  struct timeval *tv);
 ^~~
/«PKGBUILDDIR»/src/usb.c: In function 'usb_pump_events':
/«PKGBUILDDIR»/src/usb.c:519:50: error: passing argument 2 of 
'libusb_handle_events_timeout_completed' from incompatible pointer type 
[-Wincompatible-pointer-types]
 libusb_handle_events_timeout_completed(NULL, , NULL);
  ^
In file included from /«PKGBUILDDIR»/src/usb.c:23:0:
/usr/include/libusb-1.0/libusb.h:1819:17: note: expected 'struct timeval *' but 
argument is of type 'struct timeval *'
 int LIBUSB_CALL libusb_handle_events_timeout_completed(libusb_context *ctx,
 ^~
CMakeFiles/ippusbxd.dir/build.make:134: recipe for target 
'CMakeFiles/ippusbxd.dir/usb.c.o' failed
make[4]: *** [CMakeFiles/ippusbxd.dir/usb.c.o] Error 1


__linux is not defined on ppc with -std=c99, the attached patch uses
__linux__ instead for the required #include 
Description: libusb.h: use __linux__ instead of __linux
 The check was added since sys/time.h is not available on windows,
 but breaks on ppc where __linux is not defined by gcc in strict
 standards modes.
Author: Adrian Bunk 

--- libusb-1.0-1.0.21.orig/libusb/libusb.h
+++ libusb-1.0-1.0.21/libusb/libusb.h
@@ -54,7 +54,7 @@ typedef unsigned __int32  uint32_t;
 #include 
 #endif
 
-#if defined(__linux) || defined(__APPLE__) || defined(__CYGWIN__) || 
defined(__HAIKU__)
+#if defined(__linux__) || defined(__APPLE__) || defined(__CYGWIN__) || 
defined(__HAIKU__)
 #include 
 #endif
 

Bug#864980: marked as done (network-manager binary-all FTBFS: install: cannot create regular file 'debian/network-manager/etc/NetworkManager/dispatcher.d/01ifupdown': No such file or directory)

[Debian Bug Tracking System]

Your message dated Sun, 18 Jun 2017 19:56:10 +
with message-id 
and subject line Bug#864980: fixed in network-manager 1.8.0-5
has caused the Debian Bug report #864980,
regarding network-manager binary-all FTBFS: install: cannot create regular file 
'debian/network-manager/etc/NetworkManager/dispatcher.d/01ifupdown': No such 
file or directory
to be marked as done.

This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.

(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)


-- 
864980: http://bugs.debian.org/cgi-bin/bugreport.cgi?bug=864980
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---
Source: network-manager
Version: 1.8.0-4
Severity: serious

https://buildd.debian.org/status/fetch.php?pkg=network-manager=all=1.8.0-4=1497750968=0

...
dh_install -X.la --list-missing
dh_install: usr/share/doc/NetworkManager/examples/server.conf exists in 
debian/tmp but is not installed to anywhere
install -m 755 debian/network-manager-dispatcher.script \
debian/network-manager/etc/NetworkManager/dispatcher.d/01ifupdown
install: cannot create regular file 
'debian/network-manager/etc/NetworkManager/dispatcher.d/01ifupdown': No such 
file or directory
debian/rules:55: recipe for target 'override_dh_install' failed
make[1]: *** [override_dh_install] Error 1
--- End Message ---
--- Begin Message ---
Source: network-manager
Source-Version: 1.8.0-5

We believe that the bug you reported is fixed in the latest version of
network-manager, which is due to be installed in the Debian FTP archive.

A summary of the changes between this version and the previous one is
attached.

Thank you for reporting the bug, which will now be closed.  If you
have further comments please address them to 864...@bugs.debian.org,
and the maintainer will reopen the bug report if appropriate.

Debian distribution maintenance software
pp.
Michael Biebl  (supplier of updated network-manager package)

(This message was generated automatically at their request; if you
believe that there is a problem with it please contact the archive
administrators by mailing ftpmas...@ftp-master.debian.org)


-BEGIN PGP SIGNED MESSAGE-
Hash: SHA256

Format: 1.8
Date: Sun, 18 Jun 2017 21:23:48 +0200
Source: network-manager
Binary: network-manager network-manager-dev libnm-glib4 libnm-glib-dev 
libnm-glib-vpn1 libnm-glib-vpn-dev libnm-util2 libnm-util-dev libnm0 libnm-dev 
gir1.2-networkmanager-1.0 gir1.2-nm-1.0 
network-manager-config-connectivity-debian
Architecture: source
Version: 1.8.0-5
Distribution: unstable
Urgency: medium
Maintainer: Utopia Maintenance Team 

Changed-By: Michael Biebl 
Description:
 gir1.2-networkmanager-1.0 - GObject introspection data for the 
libnm-glib/libnm-util library
 gir1.2-nm-1.0 - GObject introspection data for the libnm library
 libnm-dev  - GObject-based client library for NetworkManager (development file
 libnm-glib-dev - network management framework (GLib interface)
 libnm-glib-vpn-dev - network management framework (GLib interface)
 libnm-glib-vpn1 - network management framework (GLib VPN shared library)
 libnm-glib4 - network management framework (GLib shared library)
 libnm-util-dev - network management framework (development files)
 libnm-util2 - network management framework (shared library)
 libnm0 - GObject-based client library for NetworkManager
 network-manager - network management framework (daemon and userspace tools)
 network-manager-config-connectivity-debian - NetworkManager configuration to 
enable connectivity checking
 network-manager-dev - network management framework (development files)
Closes: 864980
Changes:
 network-manager (1.8.0-5) unstable; urgency=medium
 .
   * Install ifupdown dispatcher script via network-manager.install.
 This avoids a FTBFS when doing arch:all builds.
 Rename the script to 01-ifupdown while at it for consistencies sake.
 (Closes: #864980)
   * Fix creation of network-manager.service symlink.
 Explicitly specify the network-manager package when creating the
 symlink. Otherwise the symlink is created for the wrong package when
 doing arch:all builds where the first package is not network-manager.
   * Add gir related lintian overrides.
 We deliberately ship NMClient-1.0.typelib alongside
 NetworkManager-1.0.typelib in gir1.2-networkmanager-1.0.
 Add overrides for typelib-package-name-does-not-match and
 gir-missing-typelib-dependency.
Checksums-Sha1:
 020daf672f88add59e6c633870d993b6e6dd437a 3844 network-manager_1.8.0-5.dsc
 59cb1a5b20a3c319afae5ad6ad6cb726a3bd9722 47204 

Bug#865039: libhat-trie FTBFS on 32bit: check_ahtable fails

[Adrian Bunk]

Source: libhat-trie
Version: 0.1.1-1
Severity: serious

https://buildd.debian.org/status/package.php?p=libhat-trie

...
make  check-TESTS
make[3]: Entering directory '/«PKGBUILDDIR»/test'
make[4]: Entering directory '/«PKGBUILDDIR»/test'
../test-driver: line 107: 10255 Segmentation fault  "$@" > $log_file 2>&1
FAIL: check_ahtable
PASS: check_hattrie
=
   hat-trie 0.1.1: test/test-suite.log
=

# TOTAL: 2
# PASS:  1
# SKIP:  0
# XFAIL: 0
# FAIL:  1
# XPASS: 0
# ERROR: 0

.. contents:: :depth: 2

FAIL: check_ahtable
===

generating 10 keys ... done.
inserting 20 keys ... 
sizeof: 24244359
done.
iterating through 20 keys ... 
done.
generating 10 keys ... done.
inserting 20 keys ... 
sizeof: 24240563
done.
iterating in order through 20 keys ... 
done.
generating 10 keys ... done.
inserting 20 keys ... 
sizeof: 24287070
done.
saving ahtable ... 
loading ahtable ... 
comparing ahtable ... 
FAIL check_ahtable (exit status: 139)


Testsuite summary for hat-trie 0.1.1

# TOTAL: 2
# PASS:  1
# SKIP:  0
# XFAIL: 0
# FAIL:  1
# XPASS: 0
# ERROR: 0

See test/test-suite.log
Please report to dcjo...@cs.washington.edu

Makefile:746: recipe for target 'test-suite.log' failed
make[4]: *** [test-suite.log] Error 1
make[4]: Leaving directory '/«PKGBUILDDIR»/test'
Makefile:852: recipe for target 'check-TESTS' failed
make[3]: *** [check-TESTS] Error 2
make[3]: Leaving directory '/«PKGBUILDDIR»/test'
Makefile:932: recipe for target 'check-am' failed
make[2]: *** [check-am] Error 2
make[2]: Leaving directory '/«PKGBUILDDIR»/test'
Makefile:433: recipe for target 'check-recursive' failed
make[1]: *** [check-recursive] Error 1
make[1]: Leaving directory '/«PKGBUILDDIR»'
dh_auto_test: make -j1 check VERBOSE=1 returned exit code 2
debian/rules:7: recipe for target 'build-arch' failed
make: *** [build-arch] Error 2

Bug#865005: postfix: Bug #847242 `postfix-*.prerm upgrade` removes dynamic maps, causing postfix.postinst to fail for non-default alias database types] reappeared

[Guilhem Moulin]

Package: postfix
Version: 3.2.2-1
Severity: serious
Reason: Upgrade fails for non-default database types

Dear Maintainer,

Looks like I got bitten by #847242 again when upgradating from 3.1.4-7
to 3.2.2-1.  Here is my original report, with the `apt install postfix`
output updated.

--8<--->8--

My main.cf contains

alias_maps = lmdb:/etc/aliases
alias_database = lmdb:/etc/aliases


Upgrading postfix to 3.1.3-5 fails as follows:

~$ sudo apt install postfix
[…]
The following packages will be upgraded:
   postfix (3.1.4-7 => 3.2.2-1)
   postfix-lmdb (3.1.4-7 => 3.2.2-1)
2 upgraded, 0 newly installed, 0 to remove and 33 not upgraded.
[…]
Preconfiguring packages ...
(Reading database ... 110825 files and directories currently installed.)
Preparing to unpack .../postfix-lmdb_3.2.2-1_amd64.deb ...
Removing lmdb map entry from /etc/postfix/dynamicmaps.cf
Unpacking postfix-lmdb (3.2.2-1) over (3.1.4-7) ...
Preparing to unpack .../postfix_3.2.2-1_amd64.deb ...
Removing sqlite map entry from /etc/postfix/dynamicmaps.cf
Unpacking postfix (3.2.2-1) over (3.1.4-7) ...
Processing triggers for systemd (232-25) ...
Processing triggers for man-db (2.7.6.1-2) ...
Processing triggers for rsyslog (8.24.0-1) ...
Setting up postfix (3.2.2-1) ...
Installing new version of config file /etc/postfix/makedefs.out ...

Postfix (main.cf) configuration was not changed.  If you need to make 
changes,
edit /etc/postfix/main.cf (and others) as needed.  To view Postfix
configuration values, see postconf(1).

After modifying main.cf, be sure to run 'service postfix reload'.

Running newaliases
postalias: fatal: unsupported dictionary type: lmdb. Is the postfix-lmdb 
package installed?
dpkg: error processing package postfix (--configure):
 subprocess installed post-installation script returned error exit status 1
dpkg: dependency problems prevent configuration of postfix-lmdb:
 postfix-lmdb depends on postfix (= 3.2.2-1); however:
  Package postfix is not configured yet.

dpkg: error processing package postfix-lmdb (--configure):
 dependency problems - leaving unconfigured
Errors were encountered while processing:
 postfix
 postfix-lmdb


I believe this is because postfix-lmdb.prerm removes the dynamic map during
unpacking, and doesn't re-add it before postfix.postinst calls `newaliases`.
I guess the map should only be removed upon removal (`prerm remove`), or
should be re-added by the preinst script instead.

Setting the severity to serious as this also applies to
alias_database=cdb:/etc/aliases, and I guess to all postfix-* packages
for which the prerm script removes the dynamic map during upgrade.  FWIW
reinstalling (using `apt install --reinstall postfix postfix-cdb`) fails
as well.

Thanks for maintaining Postfix in Debian!
Cheers,
-- 
Guilhem.


signature.asc
Description: PGP signature

Bug#865029: apertium-spa-cat FTBFS: No rule to make target '/usr/share/apertium/apertium-cat/cat_valencia.autogen.bin'

[Adrian Bunk]

Source: apertium-spa-cat
Version: 2.0.0~r77288-1
Severity: serious

Something recently broke the build of apertium-spa-cat:

https://tests.reproducible-builds.org/debian/history/apertium-spa-cat.html
https://tests.reproducible-builds.org/debian/rb-pkg/unstable/amd64/apertium-spa-cat.html

...
   dh_auto_build -O--fail-missing
make -j1
make[1]: Entering directory '/build/1st/apertium-spa-cat-2.0.0~r77288'
test -d .deps || mkdir .deps
touch .deps/.d
xsltproc translate-to-default-equivalent.xsl apertium-spa-cat.spa-cat.dix > 
.deps/spa-cat.dix
apertium-validate-dictionary .deps/spa-cat.dix
.deps/spa-cat.dix validates
lt-comp --var-right=cat lr .deps/spa-cat.dix spa-cat.autobil.bin
final@standard 140 7345
main@standard 69219 103035
lt-trim /usr/share/apertium/apertium-spa/spa.automorf.bin spa-cat.autobil.bin 
spa-cat.automorf.bin
final@inconditional 7 17
main@standard 79767 148732
regexp@standard 143 7426
cp /usr/share/apertium/apertium-spa/spa.lrx.bin spa.lrx.bin
cg-comp /usr/share/apertium/apertium-spa/apertium-spa.spa.rlx spa-cat.rlx.bin
Sections: 1, Rules: 285, Sets: 181, Tags: 483
cp /usr/share/apertium/apertium-spa/spa.prob spa-cat.prob
apertium-validate-dictionary .deps/spa-cat.dix
.deps/spa-cat.dix validates
lt-comp --var-right=val lr .deps/spa-cat.dix spa-cat_valencia.autobil.bin
final@standard 140 7345
main@standard 69207 103031
lrx-comp apertium-spa-cat.spa-cat.lrx spa-cat.autolex.bin
5: 81@90
cp /usr/share/apertium/apertium-cat/cat.autogen.bin spa-cat.autogen.bin
make[1]: *** No rule to make target 
'/usr/share/apertium/apertium-cat/cat_valencia.autogen.bin', needed by 
'spa-cat_valencia.autogen.bin'.  Stop.
make[1]: Leaving directory '/build/1st/apertium-spa-cat-2.0.0~r77288'
dh_auto_build: make -j1 returned exit code 2
debian/rules:9: recipe for target 'build' failed
make: *** [build] Error 2

Bug#865006: bcftools FTBFS with htslib 1.4.1-2: [E::hts_idx_push] Region 536870912..536870913 cannot be stored in a tbi index. Try using a csi index with min_shift = 14, n_lvls >= 6

[Adrian Bunk]

Source: bcftools
Version: 1.3.1-1
Severity: serious
Tags: buster sid

https://tests.reproducible-builds.org/debian/rb-pkg/unstable/amd64/bcftools.html
https://buildd.debian.org/status/fetch.php?pkg=bcftools=mips=1.3.1-1=1497794613=0

...
test_tabix:
/build/1st/bcftools-1.3.1/bcftools view -H /tmp/nSKFihjHTO/merge.a.bcf 
1:3000151-3000151
.. ok

[E::hts_idx_push] Region 536870912..536870913 cannot be stored in a tbi index. 
Try using a csi index with min_shift = 14, n_lvls >= 6
tbx_index_build failed: /tmp/nSKFihjHTO/large_chrom_tbi_limit.vcf.gz
The command failed: /usr/bin/tabix -f -p vcf 
/tmp/nSKFihjHTO/large_chrom_tbi_limit.vcf.gz
 at ./test/test.pl line 259.
main::error("The command failed: /usr/bin/tabix -f -p vcf 
/tmp/nSKFihjHTO/"..., "") called at ./test/test.pl line 315
main::cmd("/usr/bin/tabix -f -p vcf 
/tmp/nSKFihjHTO/large_chrom_tbi_limi"...) called at ./test/test.pl line 406
main::bgzip_tabix(HASH(0x564bf0d26f48), "file", 
"large_chrom_tbi_limit", "suffix", "vcf", "args", "-p vcf") called at 
./test/test.pl line 414
main::bgzip_tabix_vcf(HASH(0x564bf0d26f48), "large_chrom_tbi_limit") 
called at ./test/test.pl line 423
main::test_tabix(HASH(0x564bf0d26f48), "in", "large_chrom_tbi_limit", 
"reg", "chr11:1-536870912", "out", "large_chrom_tbi_limit.20.1.536870912.out") 
called at ./test/test.pl line 39
Makefile:102: recipe for target 'test' failed
make[1]: *** [test] Error 1
make[1]: Leaving directory '/build/1st/bcftools-1.3.1'
dh_auto_test: make -j16 test returned exit code 2
debian/rules:11: recipe for target 'build' failed
make: *** [build] Error 2

Bug#865008: samtools FTBFS with htslib 1.4.1-2: error: conflicting types for 'errmod_t'

[Adrian Bunk]

Source: samtools
Version: 1.3.1-3
Severity: serious
Tags: buster sid

https://tests.reproducible-builds.org/debian/rb-pkg/unstable/amd64/samtools.html
https://buildd.debian.org/status/fetch.php?pkg=samtools=mips=1.3.1-3=1497794431=0

...
gcc -g -O2 -fstack-protector-strong -Wformat -Werror=format-security -I.
-Wdate-time -D_FORTIFY_SOURCE=2 -c -o bam2bcf_indel.o bam2bcf_indel.c
In file included from bam2bcf.h:31:0,
 from bam2bcf_indel.c:32:
errmod.h:36:3: error: conflicting types for 'errmod_t'
 } errmod_t;
   ^~~~
In file included from /usr/include/htslib/sam.h:31:0,
 from bam2bcf_indel.c:31:
/usr/include/htslib/hts.h:659:25: note: previous declaration of 'errmod_t' was 
here
 typedef struct errmod_t errmod_t;
 ^~~~
...

Bug#865014: haskell-cabal-helper FTBFS: dh_install: Cannot find (any matches for) "dist-ghc/build/cabal-helper-wrapper-v0.7/cabal-helper-wrapper-v0.7"

[Adrian Bunk]

Source: haskell-cabal-helper
Version: 0.7.3.0-1
Severity: serious

https://buildd.debian.org/status/package.php?p=haskell-cabal-helper=sid

...
dh_bugfiles -pcabal-helper 
dh_install -pcabal-helper 
dh_install: Cannot find (any matches for) 
"dist-ghc/build/cabal-helper-wrapper-v0.7/cabal-helper-wrapper-v0.7" (tried in 
"." and "debian/tmp")
dh_install: cabal-helper missing files: 
dist-ghc/build/cabal-helper-wrapper-v0.7/cabal-helper-wrapper-v0.7
dh_install: missing files, aborting
/usr/share/cdbs/1/rules/debhelper.mk:233: recipe for target 
'binary-install/cabal-helper' failed
make: *** [binary-install/cabal-helper] Error 2

Processed: libusb.h: __linux usage makes ippusbxd FTBFS on ppc

[Debian Bug Tracking System]

Processing control commands:

> affects -1 src:ippusbxd
Bug #865026 [libusb-1.0-0-dev] libusb.h: __linux usage makes ippusbxd FTBFS on 
ppc
Added indication that 865026 affects src:ippusbxd

-- 
865026: http://bugs.debian.org/cgi-bin/bugreport.cgi?bug=865026
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems

Bug#864302: marked as done (request-tracker4: FTBFS due to base.pm changes in July 2016)

[Debian Bug Tracking System]

Your message dated Sun, 18 Jun 2017 21:52:31 +0100
with message-id <20170618205231.5gkvsikw7jmdo...@urchin.earth.li>
and subject line Fixed in last upload to jessie
has caused the Debian Bug report #864302,
regarding request-tracker4: FTBFS due to base.pm changes in July 2016
to be marked as done.

This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.

(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)


-- 
864302: http://bugs.debian.org/cgi-bin/bugreport.cgi?bug=864302
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---
Source: request-tracker4
Version: 4.2.8-3+deb8u1
Severity: serious
Justification: ftbfs
Tags: jessie patch

As per

http://perl.debian.net/rebuild-logs/jessie/request-tracker4_4.2.8-3+deb8u1/request-tracker4_4.2.8-3+deb8u1_amd64-2017-06-05T20:11:50Z.build

building this package was broken by the changes in perl to fix the '.'
in @INC vulnerability.

The breakage doesn't appear in the version in unstable, though it's
not immediately obvious why. There is a proposed fix in

https://anonscm.debian.org/cgit/pkg-request-tracker/request-tracker4.git/log/?h=ntyni/jessie-base-pm

Dominic.
--- End Message ---
--- Begin Message ---
Version: 4.2.8-3+deb8u2--- End Message ---

Bug#865007: libtabixpp FTBFS with htslib 1.4.1-2: devlibs error: There is no package matching [libhts2-dev] and noone provides it

[Adrian Bunk]

Source: libtabixpp
Version: 1.0.0-2
Severity: serious

https://tests.reproducible-builds.org/debian/rb-pkg/unstable/amd64/libtabixpp.html
https://buildd.debian.org/status/fetch.php?pkg=libtabixpp=mips=1.0.0-2=1497795657=0

...
make[1]: Entering directory '/build/1st/libtabixpp-1.0.0'
ln -s libtabixpp.so.* libtabixpp.so
d-shlibmove --commit \
--multiarch \
--devunversioned \
--override s/libhts1-dev/libhts-dev/ \
--movedev "*.hpp" usr/include/ \
libtabixpp.so
Library package automatic movement utility
devlibs error: There is no package matching [libhts2-dev] and noone provides 
it, please report bug to d-shlibs maintainer
debian/rules:10: recipe for target 'override_dh_auto_install' failed
make[1]: *** [override_dh_auto_install] Error 1


The --override parameter needs an libhts1-dev -> libhts2-dev.

Bug#865015: debian-installer: Live installers are unable to start, "There was a problem reading data from the CD-ROM"

[Steve McIntyre]

On Mon, Jun 19, 2017 at 12:19:07AM +0200, Cyril Brulebois wrote:
>Control: reassign -1 live-installer
>
>Francisco Gómez  (2017-06-18):
>> Package: debian-installer
>> Severity: grave
>> Justification: renders package unusable
>> 
>> When trying to install Debian, the installer is unable to start, and the
>> following error appears:
>> 
>> "There was an error reading data from the CD-ROM. Please make sure it is in 
>> the
>> drive. If retrying does not work, you should check the integrity of your CD-
>> ROM."
>> 
>> Retrying does not solve the problem. On the console, with an AMD64 image, the
>> following output is displayed:
>> 
>> cdrom-retriever: error: Unable to find
>> `/w/work/free/gnomepool/main/libl/libzlo2-2-udeb/libzlo2-2-udeb_2.08-1.2+b2_amd64.udeb`
>> 
>> This has been tested with the live image 
>> "debian-9.0.0-amd64-i386-netinst.iso"
>> on multiple machines by multiple people, including on my iMac via Virtualbox,
>> downloaded from torrent.
>
>This seems to have been independently discovered by Steve (“the Packages
>files in the image point to .debs using full path, not relative to the
>stuff in the image”). Reassigning to live-installer, which might not be
>the correct package, but is probably better than just debian-installer.

That's fair enough. I think I've found a bug in live-wrapper here, and
I'm testing a fix already.

-- 
Steve McIntyre, Cambridge, UK.st...@einval.com
"I used to be the first kid on the block wanting a cranial implant,
 now I want to be the first with a cranial firewall. " -- Charlie Stross

Bug#865062: haskell-sockets: FTBFS due to missing B-D on libghc-sha-dev/prof

[James Clarke]

Source: haskell-websockets
Version: 0.9.8.2-1
Severity: serious

Hi,
It seems the B-D on libghc-sha-dev got dropped when importing the new
upstream version; it's still needed:

> hlibrary.setup: Encountered missing dependencies:
> SHA >=1.5 && <1.7
> /usr/share/cdbs/1/class/hlibrary.mk:142: recipe for target 
> 'configure-ghc-stamp' failed

Regards,
James

Processed: Re: Bug#865058: nvidia-kernel-dkms: builds empty nvidia-current-drm.ko module with 4.9.0-3 kernel

[Debian Bug Tracking System]

Processing control commands:

> tag -1 moreinfo unreproducible
Bug #865058 [nvidia-kernel-dkms] nvidia-kernel-dkms: builds empty 
nvidia-current-drm.ko module with 4.9.0-3 kernel
Added tag(s) unreproducible and moreinfo.

-- 
865058: http://bugs.debian.org/cgi-bin/bugreport.cgi?bug=865058
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems

Bug#865058: nvidia-kernel-dkms: builds empty nvidia-current-drm.ko module with 4.9.0-3 kernel

[Andreas Beckmann]

Control: tag -1 moreinfo unreproducible

On 2017-06-19 00:56, Patrick O'Doherty wrote:

> Apologies if this is the wrong package against the file the bug. It
> might well be the case that this issue lies with linux-image-4.9.0-3. 
> 
> nvidia-kernel-dkms produces an empty "nvidia-current-drm.ko" file when
> built against this kernel version. This causes issues at boot and the
> following log lines: 
> 
> systemd-modules-load[395]: modprobe: ERROR: could not insert 
> 'nvidia_current_drm': Invalid argument
> systemd-modules-load[395]: Error running install command for nvidia_drm

> Kernel modules: nvidia.ko
> /lib/modules/4.9.0-3-amd64/updates/dkms/nvidia-current-modeset.ko
> /lib/modules/4.9.0-3-amd64/updates/dkms/nvidia-current-drm.ko
> /lib/modules/4.9.0-3-amd64/updates/dkms/nvidia-current.ko
> /lib/modules/4.9.0-3-amd64/updates/dkms/nvidia-current-uvm.ko
> 
> filename:   
> /lib/modules/4.9.0-3-amd64/updates/dkms/nvidia-current-modeset.ko
> version:375.66
> supported:  external
> license:NVIDIA
> srcversion: 252CFD821549601A1591E20
> depends:nvidia
> vermagic:   4.9.0-3-amd64 SMP mod_unload modversions 
> filename:   /lib/modules/4.9.0-3-amd64/updates/dkms/nvidia-current-drm.ko
> filename:   /lib/modules/4.9.0-3-amd64/updates/dkms/nvidia-current.ko
> alias:  char-major-195-*
> version:375.66
> supported:  external
> license:NVIDIA
> srcversion: 68751AFD79A210CEFFB8758
> alias:  pci:v10DEd0E00sv*sd*bc04sc80i00*
> alias:  pci:v10DEd*sv*sd*bc03sc02i00*
> alias:  pci:v10DEd*sv*sd*bc03sc00i00*
> depends:
> vermagic:   4.9.0-3-amd64 SMP mod_unload modversions 
> filename:   /lib/modules/4.9.0-3-amd64/updates/dkms/nvidia-current-uvm.ko
> supported:  external
> license:MIT
> depends:nvidia
> vermagic:   4.9.0-3-amd64 SMP mod_unload modversions 

I just tried it in a sid chroot (linux-headers-4.9.0-3-amd64 (4.9.30-2)
and nvidia-kernel-dkms (375.66-2)) and it built these files:

# ls -la /lib/modules/4.9.0-3-amd64/updates/dkms/
total 18584
drwxr-xr-x 2 root root  120 Jun 19 02:23 .
drwxr-xr-x 3 root root   60 Jun 19 02:23 ..
-rw-r--r-- 1 root root85552 Jun 19 02:23 nvidia-current-drm.ko
-rw-r--r-- 1 root root  1085784 Jun 19 02:23 nvidia-current-modeset.ko
-rw-r--r-- 1 root root  1115656 Jun 19 02:23 nvidia-current-uvm.ko
-rw-r--r-- 1 root root 16732640 Jun 19 02:23 nvidia-current.ko

# modinfo /lib/modules/4.9.0-3-amd64/updates/dkms/nvidia-current-drm.ko
filename:
/lib/modules/4.9.0-3-amd64/updates/dkms/nvidia-current-drm.ko
version:375.66
supported:  external
license:MIT
srcversion: C4CEF74C8A748A2437DB582
alias:  pci:v10DEd0E00sv*sd*bc04sc80i00*
alias:  pci:v10DEd*sv*sd*bc03sc02i00*
alias:  pci:v10DEd*sv*sd*bc03sc00i00*
depends:drm,drm_kms_helper,nvidia-modeset
vermagic:   4.9.0-3-amd64 SMP mod_unload modversions
parm:   modeset:Enable atomic kernel modesetting (1 = enable, 0
= disable (default)) (bool)

Since your module does not give any useful output from modinfo,
something went wrong on your machine - could be dkms or kernel.
Have you tried the nvidia-kernel-source package? Does that build a
usable module?


Andreas

Processed: forwarded upstream

[Debian Bug Tracking System]

Processing commands for cont...@bugs.debian.org:

> forwarded 863934 https://github.com/felixge/node-dateformat/issues/41
Bug #863934 [src:node-dateformat] node-dateformat: FTBFS: Test failures 
("AssertionError: '1:19:44 PM GMT+' === '1:19:44 PM UTC")
Set Bug forwarded-to-address to 
'https://github.com/felixge/node-dateformat/issues/41'.
>
End of message, stopping processing here.

Please contact me if you need assistance.
-- 
863934: http://bugs.debian.org/cgi-bin/bugreport.cgi?bug=863934
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems

Bug#839208: marked as done (libio-compress-perl: uninstallable, current version superseded by Perl 5.24.1)

[Debian Bug Tracking System]

Your message dated Sun, 18 Jun 2017 14:51:39 +
with message-id 
and subject line Bug#839208: fixed in libio-compress-perl 2.074-1
has caused the Debian Bug report #839208,
regarding libio-compress-perl: uninstallable, current version superseded by 
Perl 5.24.1
to be marked as done.

This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.

(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)


-- 
839208: http://bugs.debian.org/cgi-bin/bugreport.cgi?bug=839208
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---
Package: libio-compress-perl
Version: 2.069-1
Severity: grave

This package is currently uninstallable on sid (and stretch), because
Perl 5.24.1(-RC3) bundles a newer version. This is not a problem as
perl Provides a virtual package with the same name, so any (unversioned)
dependencies are still satisfied.

This bug should be closed by uploading a newer upstream version or having
the separate package removed.
-- 
Niko Tyni   nt...@debian.org
--- End Message ---
--- Begin Message ---
Source: libio-compress-perl
Source-Version: 2.074-1

We believe that the bug you reported is fixed in the latest version of
libio-compress-perl, which is due to be installed in the Debian FTP archive.

A summary of the changes between this version and the previous one is
attached.

Thank you for reporting the bug, which will now be closed.  If you
have further comments please address them to 839...@bugs.debian.org,
and the maintainer will reopen the bug report if appropriate.

Debian distribution maintenance software
pp.
gregor herrmann  (supplier of updated libio-compress-perl 
package)

(This message was generated automatically at their request; if you
believe that there is a problem with it please contact the archive
administrators by mailing ftpmas...@ftp-master.debian.org)


-BEGIN PGP SIGNED MESSAGE-
Hash: SHA512

Format: 1.8
Date: Sun, 18 Jun 2017 16:34:22 +0200
Source: libio-compress-perl
Binary: libio-compress-perl
Architecture: source
Version: 2.074-1
Distribution: unstable
Urgency: medium
Maintainer: Debian Perl Group 
Changed-By: gregor herrmann 
Closes: 839208
Description: 
 libio-compress-perl - bundle of IO::Compress modules
Changes:
 libio-compress-perl (2.074-1) unstable; urgency=medium
 .
   [ gregor herrmann ]
   * Rename autopkgtest configuration file.
 .
   [ Salvatore Bonaccorso ]
   * debian/control: Use HTTPS transport protocol for Vcs-Git URI
 .
   [ gregor herrmann ]
   * debian/copyright: change Copyright-Format 1.0 URL to HTTPS.
   * Remove Jonathan Yu from Uploaders. Thanks for your work!
   * Remove Ryan Niebur from Uploaders. Thanks for your work!
 .
   [ Nick Morrott ]
   * New upstream version 2.070 (Closes: #839208)
   * debian/copyright: update copyright years
   * debian/control: declare compliance with Debian Policy 3.9.8
   * debian/control: refresh build-dependencies
   * debian/upstream/metadata: add Bug-* fields
   * Add debian/libio-compress-perl.lintian-overrides
 .
   [ gregor herrmann ]
   * Import upstream version 2.074
   * Set TEST_SKIP_VERSION_CHECK=1 for autopkgtest as well.
   * Update years of upstream and packaging copyright.
   * debian/control: bump versioned build dependencies.
   * Drop Breaks/Replaces against ancient packages which are not even in
 oldoldstable anymore. Also drop the Provides for them; there are still
 consumers but the same virtual packages are provided by src:perl.
   * Add debian/tests/pkg-perl/use-name to activate autopkgtest's use.t.
Checksums-Sha1: 
 b71f68ebb6b87b75f19462d1b59f1d5c3dddfb19 2448 libio-compress-perl_2.074-1.dsc
 c22e79a1b955b1b7da4d29d9e0d9bf96e4fe95f3 243731 
libio-compress-perl_2.074.orig.tar.gz
 2ebb1d27d1f2aba977473a241769744fbb9a2939 4884 
libio-compress-perl_2.074-1.debian.tar.xz
Checksums-Sha256: 
 121744b36bcc23ccd075c8c4088c0d9ae2cad7756d61d24f7ae57b995e803a0c 2448 
libio-compress-perl_2.074-1.dsc
 b4bd68ce895a6578e5be96ade36449461becc328cc7ab900ae4e362380f097f2 243731 
libio-compress-perl_2.074.orig.tar.gz
 cb9f9985ce9079c6027e4289107a2ef051813504fb9c1443de14cd356f5e574b 4884 
libio-compress-perl_2.074-1.debian.tar.xz
Files: 
 46f578b9594869aa8291e4a45b085809 2448 perl optional 
libio-compress-perl_2.074-1.dsc
 117232322523b5113f6bfc073d41eb69 243731 perl optional 
libio-compress-perl_2.074.orig.tar.gz
 0c5842e285620f15c72c7b475f5d40e8 4884 perl optional 
libio-compress-perl_2.074-1.debian.tar.xz

-BEGIN PGP SIGNATURE-

iQKTBAEBCgB9FiEE0eExbpOnYKgQTYX6uzpoAYZJqgYFAllGj5tfFIAALgAo

Bug#864947: [Parl-devel] Bug#864947: parl-desktop-world depends on cruft package firefox-esr-l10n-be

[Jonas Smedegaard]

Quoting peter green (2017-06-17 21:49:38)
> Package: debian-parl
> Severity: serious
> Version: 1.9.10
> 
> parl-desktop-world depends on firefox-esr-l10n-be which is no longer 
> built by firefox-esr. I'm still trying to figure out where this is 
> coming from, I can't find any evidence of it in the source package but 
> rebuilding the binaries doesn't make it go away.

I do not see that relationship in version 1.9.10 of parl-desktop-world - 
are you sure you are referring to that exact version of the package (not 
e.g. some rebuild of the package from source)?

 - Jonas

-- 
 * Jonas Smedegaard - idealist & Internet-arkitekt
 * Tlf.: +45 40843136  Website: http://dr.jones.dk/

 [x] quote me freely  [ ] ask before reusing  [ ] keep private


signature.asc
Description: signature

Bug#860831: marked as done (debian-archive-keyring: release key for stretch?)

[Debian Bug Tracking System]

Your message dated Sun, 18 Jun 2017 13:17:21 +
with message-id 
and subject line Bug#860831: fixed in debian-archive-keyring 2017.5~deb8u1
has caused the Debian Bug report #860831,
regarding debian-archive-keyring: release key for stretch?
to be marked as done.

This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.

(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)


-- 
860831: http://bugs.debian.org/cgi-bin/bugreport.cgi?bug=860831
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---
Source: debian-archive-keyring
Version: 2014.3
Control: found -1 2014.3~deb7u1
X-Debbugs-Cc: debian-rele...@lists.debian.org

Hi,

There was some debate a little while ago as to the merits of the release
signing keys, but if we're going to have one for stretch then we should
get it generated and include in d-a-k uploads in the near future.

Regards,

Adam
--- End Message ---
--- Begin Message ---
Source: debian-archive-keyring
Source-Version: 2017.5~deb8u1

We believe that the bug you reported is fixed in the latest version of
debian-archive-keyring, which is due to be installed in the Debian FTP archive.

A summary of the changes between this version and the previous one is
attached.

Thank you for reporting the bug, which will now be closed.  If you
have further comments please address them to 860...@bugs.debian.org,
and the maintainer will reopen the bug report if appropriate.

Debian distribution maintenance software
pp.
Jonathan Wiltshire  (supplier of updated 
debian-archive-keyring package)

(This message was generated automatically at their request; if you
believe that there is a problem with it please contact the archive
administrators by mailing ftpmas...@ftp-master.debian.org)


-BEGIN PGP SIGNED MESSAGE-
Hash: SHA256

Format: 1.8
Date: Sun, 18 Jun 2017 12:11:58 +0100
Source: debian-archive-keyring
Binary: debian-archive-keyring debian-archive-keyring-udeb
Architecture: source all
Version: 2017.5~deb8u1
Distribution: jessie
Urgency: medium
Maintainer: Debian Release Team 
Changed-By: Jonathan Wiltshire 
Description:
 debian-archive-keyring - GnuPG archive keys of the Debian archive
 debian-archive-keyring-udeb - GnuPG keys of the Debian archive (udeb)
Closes: 860830 860831 863303
Changes:
 debian-archive-keyring (2017.5~deb8u1) jessie; urgency=medium
 .
   * Team upload.
   * Update jessie with 2017.5, closes: #860831, 860830, 863303
Checksums-Sha1:
 5f53c20cb5a8505ec7ef61b38370a70a584d8599 1639 
debian-archive-keyring_2017.5~deb8u1.dsc
 89d964e911b5358ed7a79d4587622d4f77923233 79444 
debian-archive-keyring_2017.5~deb8u1.tar.xz
 3d7257dc79cf938143b8acf6ffa8e20d3de68dc0 56652 
debian-archive-keyring_2017.5~deb8u1_all.deb
 86c21d99f01a100b993eaa78f92b925300a1fd1f 35962 
debian-archive-keyring-udeb_2017.5~deb8u1_all.udeb
Checksums-Sha256:
 d03d8d53a0e20a4155a95d6fcea2a4c4773f2852025d6b2aee38be7a5818937e 1639 
debian-archive-keyring_2017.5~deb8u1.dsc
 9db751cf3479351a2d60ff5fc6b59e0b780bc2cffc94103f0e02b0b12a25245b 79444 
debian-archive-keyring_2017.5~deb8u1.tar.xz
 ff7e2b6cd43e4c5a9a9cb55374a362b8061c2002940b6335b79eb4a3f12555fb 56652 
debian-archive-keyring_2017.5~deb8u1_all.deb
 6f22aef5242bd4345fdf395fa8e23151f6d7f0a257cfdc36a72f4e3beba990e3 35962 
debian-archive-keyring-udeb_2017.5~deb8u1_all.udeb
Files:
 ef13ed478955e2a4b46d67daf1900c8b 1639 misc important 
debian-archive-keyring_2017.5~deb8u1.dsc
 979a010e409950ac6f996a9dc0476f9d 79444 misc important 
debian-archive-keyring_2017.5~deb8u1.tar.xz
 0352073abd392c6fd72077fd1b8c0b4e 56652 misc important 
debian-archive-keyring_2017.5~deb8u1_all.deb
 b60a9ae8d1bbcbbba8ac147a947f9c7a 35962 debian-installer optional 
debian-archive-keyring-udeb_2017.5~deb8u1_all.udeb
Package-Type: udeb

-BEGIN PGP SIGNATURE-

iQIzBAEBCAAdFiEEADLdyLGMneGYn8dtRNMqtfom+MkFAllGZX8ACgkQRNMqtfom
+MnsUw//QTa0i4mSJYfLtHIIh8Bp2MhWhFLm2Muz/W4pE/0Z9Z8NvPO14M32URMX
dA1efLRDzGMH3atsZUTRSO2z364MRoVP17y9R+nu7LBH/RJJPgyw4rTzkJlNXoTN
dsg61RATl0Rhfal7O53L0E2sTuTMCRVrhdfG6kDzg2VikitGkVxnEdDUk1tpZT9A
YiERvK7uGc1D2mHTBfFPHZ9pSkoV8oiNw2e9aX56nmPkgr2DYaldt6hlzRMmGKWh
6IwOpUo0plIUKThaHyRX+z+rdFyuTbzCg4YWdfhnXZf6Y1rGIAHHS2hNAgT4poA0
K6V9YcRZtbQHQGjKHsC2dfNlM2N+YfXK7Pdy+NuWglYoMeyLKTfGfkGmPhQRNee0
hu3s+Ngz6VM0lnjSt/RyP9xHN+IlZHSzTVGjrGWfWxRCnT1lgU5IrZlCfMbal/bz
HLRdlhejmgPYnccpqSIy2X4ajuGk1EWi0UN4YCFFY/ia/5YtQ9XiVEKmGKKWIavN
00YBYiKYPx7vSYhosnGY4ah2thEwu8TaXZ1fDHKfJ7MJ97oRKmpwZNE7kj3VVwZ3
7Ilu9MetiFFzOK5WIir1vjRhOMGbmi75oRBMPaab6iKinI/xqki7q/CFgJUOeiiT
rxyvmRO/Q8rva6bF/16aYhOUN0YwqdbDzFSaJeVQDQGsSIzBbh4=
=ZzpC
-END PGP SIGNATURE End Message ---

Bug#860830: marked as done (debian-archive-keyring: ftp-master key for stretch)

[Debian Bug Tracking System]

Your message dated Sun, 18 Jun 2017 13:17:21 +
with message-id 
and subject line Bug#860830: fixed in debian-archive-keyring 2017.5~deb8u1
has caused the Debian Bug report #860830,
regarding debian-archive-keyring: ftp-master key for stretch
to be marked as done.

This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.

(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)


-- 
860830: http://bugs.debian.org/cgi-bin/bugreport.cgi?bug=860830
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---
Source: debian-archive-keyring
Version: 2014.3
Control: found -1 2014.3~deb7u1
X-Debbugs-Cc: ftpmas...@debian.org, debian-rele...@lists.debian.org

Hi,

Assuming I didn't miss an announcement already, we need new archive
signing keys for stretch, so we can include them in a
debian-archive-keyring upload before the release.

Regards,

Adam
--- End Message ---
--- Begin Message ---
Source: debian-archive-keyring
Source-Version: 2017.5~deb8u1

We believe that the bug you reported is fixed in the latest version of
debian-archive-keyring, which is due to be installed in the Debian FTP archive.

A summary of the changes between this version and the previous one is
attached.

Thank you for reporting the bug, which will now be closed.  If you
have further comments please address them to 860...@bugs.debian.org,
and the maintainer will reopen the bug report if appropriate.

Debian distribution maintenance software
pp.
Jonathan Wiltshire  (supplier of updated 
debian-archive-keyring package)

(This message was generated automatically at their request; if you
believe that there is a problem with it please contact the archive
administrators by mailing ftpmas...@ftp-master.debian.org)


-BEGIN PGP SIGNED MESSAGE-
Hash: SHA256

Format: 1.8
Date: Sun, 18 Jun 2017 12:11:58 +0100
Source: debian-archive-keyring
Binary: debian-archive-keyring debian-archive-keyring-udeb
Architecture: source all
Version: 2017.5~deb8u1
Distribution: jessie
Urgency: medium
Maintainer: Debian Release Team 
Changed-By: Jonathan Wiltshire 
Description:
 debian-archive-keyring - GnuPG archive keys of the Debian archive
 debian-archive-keyring-udeb - GnuPG keys of the Debian archive (udeb)
Closes: 860830 860831 863303
Changes:
 debian-archive-keyring (2017.5~deb8u1) jessie; urgency=medium
 .
   * Team upload.
   * Update jessie with 2017.5, closes: #860831, 860830, 863303
Checksums-Sha1:
 5f53c20cb5a8505ec7ef61b38370a70a584d8599 1639 
debian-archive-keyring_2017.5~deb8u1.dsc
 89d964e911b5358ed7a79d4587622d4f77923233 79444 
debian-archive-keyring_2017.5~deb8u1.tar.xz
 3d7257dc79cf938143b8acf6ffa8e20d3de68dc0 56652 
debian-archive-keyring_2017.5~deb8u1_all.deb
 86c21d99f01a100b993eaa78f92b925300a1fd1f 35962 
debian-archive-keyring-udeb_2017.5~deb8u1_all.udeb
Checksums-Sha256:
 d03d8d53a0e20a4155a95d6fcea2a4c4773f2852025d6b2aee38be7a5818937e 1639 
debian-archive-keyring_2017.5~deb8u1.dsc
 9db751cf3479351a2d60ff5fc6b59e0b780bc2cffc94103f0e02b0b12a25245b 79444 
debian-archive-keyring_2017.5~deb8u1.tar.xz
 ff7e2b6cd43e4c5a9a9cb55374a362b8061c2002940b6335b79eb4a3f12555fb 56652 
debian-archive-keyring_2017.5~deb8u1_all.deb
 6f22aef5242bd4345fdf395fa8e23151f6d7f0a257cfdc36a72f4e3beba990e3 35962 
debian-archive-keyring-udeb_2017.5~deb8u1_all.udeb
Files:
 ef13ed478955e2a4b46d67daf1900c8b 1639 misc important 
debian-archive-keyring_2017.5~deb8u1.dsc
 979a010e409950ac6f996a9dc0476f9d 79444 misc important 
debian-archive-keyring_2017.5~deb8u1.tar.xz
 0352073abd392c6fd72077fd1b8c0b4e 56652 misc important 
debian-archive-keyring_2017.5~deb8u1_all.deb
 b60a9ae8d1bbcbbba8ac147a947f9c7a 35962 debian-installer optional 
debian-archive-keyring-udeb_2017.5~deb8u1_all.udeb
Package-Type: udeb

-BEGIN PGP SIGNATURE-

iQIzBAEBCAAdFiEEADLdyLGMneGYn8dtRNMqtfom+MkFAllGZX8ACgkQRNMqtfom
+MnsUw//QTa0i4mSJYfLtHIIh8Bp2MhWhFLm2Muz/W4pE/0Z9Z8NvPO14M32URMX
dA1efLRDzGMH3atsZUTRSO2z364MRoVP17y9R+nu7LBH/RJJPgyw4rTzkJlNXoTN
dsg61RATl0Rhfal7O53L0E2sTuTMCRVrhdfG6kDzg2VikitGkVxnEdDUk1tpZT9A
YiERvK7uGc1D2mHTBfFPHZ9pSkoV8oiNw2e9aX56nmPkgr2DYaldt6hlzRMmGKWh
6IwOpUo0plIUKThaHyRX+z+rdFyuTbzCg4YWdfhnXZf6Y1rGIAHHS2hNAgT4poA0
K6V9YcRZtbQHQGjKHsC2dfNlM2N+YfXK7Pdy+NuWglYoMeyLKTfGfkGmPhQRNee0
hu3s+Ngz6VM0lnjSt/RyP9xHN+IlZHSzTVGjrGWfWxRCnT1lgU5IrZlCfMbal/bz
HLRdlhejmgPYnccpqSIy2X4ajuGk1EWi0UN4YCFFY/ia/5YtQ9XiVEKmGKKWIavN
00YBYiKYPx7vSYhosnGY4ah2thEwu8TaXZ1fDHKfJ7MJ97oRKmpwZNE7kj3VVwZ3
7Ilu9MetiFFzOK5WIir1vjRhOMGbmi75oRBMPaab6iKinI/xqki7q/CFgJUOeiiT
rxyvmRO/Q8rva6bF/16aYhOUN0YwqdbDzFSaJeVQDQGsSIzBbh4=
=ZzpC
-END PGP SIGNATURE End Message ---

Processed: tag cleanup

[Debian Bug Tracking System]

Processing commands for cont...@bugs.debian.org:

> tags 852904 - buster
Bug #852904 {Done: Andreas Metzler } [libp11-kit0] 
gnutls28: FTBFS: Test failures
Bug #852227 {Done: Andreas Metzler } [libp11-kit0] 
libp11-kit0: Temporarily block migration of 0.23.3-4 to testing
Removed tag(s) buster.
Removed tag(s) buster.
> tags 852904 - sid
Bug #852904 {Done: Andreas Metzler } [libp11-kit0] 
gnutls28: FTBFS: Test failures
Bug #852227 {Done: Andreas Metzler } [libp11-kit0] 
libp11-kit0: Temporarily block migration of 0.23.3-4 to testing
Removed tag(s) sid.
Removed tag(s) sid.
> archive 852904
Bug #852904 {Done: Andreas Metzler } [libp11-kit0] 
gnutls28: FTBFS: Test failures
Bug #852227 {Done: Andreas Metzler } [libp11-kit0] 
libp11-kit0: Temporarily block migration of 0.23.3-4 to testing
archived 852904 to archive/04 (from 852904)
archived 852227 to archive/27 (from 852904)
> tags 853401 - sid
Bug #853401 {Done: Andreas Metzler } [src:findutils] 
findutils: ftbfs with GCC-7
Removed tag(s) sid.
> tags 853401 - buster
Bug #853401 {Done: Andreas Metzler } [src:findutils] 
findutils: ftbfs with GCC-7
Removed tag(s) buster.
> tags 853447 - sid
Bug #853447 [src:hugin] hugin: ftbfs with GCC-7
Removed tag(s) sid.
> tags 853447 - buster
Bug #853447 [src:hugin] hugin: ftbfs with GCC-7
Removed tag(s) buster.
>
End of message, stopping processing here.

Please contact me if you need assistance.
-- 
852227: http://bugs.debian.org/cgi-bin/bugreport.cgi?bug=852227
852904: http://bugs.debian.org/cgi-bin/bugreport.cgi?bug=852904
853401: http://bugs.debian.org/cgi-bin/bugreport.cgi?bug=853401
853447: http://bugs.debian.org/cgi-bin/bugreport.cgi?bug=853447
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems

Bug#855058: Looks as if this was a transient failure

[Santiago Vila]

On Wed, 24 May 2017, Adrian Bunk wrote:

> After retries the builds succeeded a few days later on the buildds.
> 
> The reproducible builds [1] do unfortunately not contain any builds from 
> the relevant timespan, but based on the fact that the build never failed 
> there before or after I'll assume this was a transient failure that is
> long gone.

Hello Adrian.

My build history for this package:

Status: successful  gtk-vnc_0.6.0-2_amd64-20170520T121435Z
Status: successful  gtk-vnc_0.6.0-2_amd64-20170523T165859Z
Status: failed  gtk-vnc_0.6.0-3_amd64-20170524T113052Z
Status: failed  gtk-vnc_0.6.0-3_amd64-20170529T084121Z
Status: failed  gtk-vnc_0.6.0-3_amd64-20170602T095544Z
Status: failed  gtk-vnc_0.6.0-3_amd64-20170610T113822Z
Status: failed  gtk-vnc_0.6.0-3_amd64-20170615T123506Z

This does not seem transient to me.
Can you try again in stretch a few more times and share the results?

I've also triggered a rebuild in reproducible-builds (for both stretch
and unstable), but packages failing there do not always fail with
sbuild and vice-versa.

Thanks.

Bug#864979: htslib FTBFS: ln: target '/<>/debian/htslib-test/usr/share/htslib-test/cram/' is not a directory: No such file or directory

[Adrian Bunk]

Source: htslib
Version: 1.4.1-1
Severity: serious

https://buildd.debian.org/status/package.php?p=htslib=sid

...
# provide header files as expected by the Makefile of the test suite via 
symlinks
for l in `ls debian/libhts-dev/usr/include/htslib/cram/*.h` ; do \
ln -s ../../../include/htslib/cram/`basename $l` 
/<>/debian/htslib-test/usr/share/htslib-test/cram/ ; \
done
ln: target '/<>/debian/htslib-test/usr/share/htslib-test/cram/' is 
not a directory: No such file or directory
ln: target '/<>/debian/htslib-test/usr/share/htslib-test/cram/' is 
not a directory: No such file or directory
ln: target '/<>/debian/htslib-test/usr/share/htslib-test/cram/' is 
not a directory: No such file or directory
ln: target '/<>/debian/htslib-test/usr/share/htslib-test/cram/' is 
not a directory: No such file or directory
ln: target '/<>/debian/htslib-test/usr/share/htslib-test/cram/' is 
not a directory: No such file or directory
ln: target '/<>/debian/htslib-test/usr/share/htslib-test/cram/' is 
not a directory: No such file or directory
ln: target '/<>/debian/htslib-test/usr/share/htslib-test/cram/' is 
not a directory: No such file or directory
ln: target '/<>/debian/htslib-test/usr/share/htslib-test/cram/' is 
not a directory: No such file or directory
ln: target '/<>/debian/htslib-test/usr/share/htslib-test/cram/' is 
not a directory: No such file or directory
ln: target '/<>/debian/htslib-test/usr/share/htslib-test/cram/' is 
not a directory: No such file or directory
ln: target '/<>/debian/htslib-test/usr/share/htslib-test/cram/' is 
not a directory: No such file or directory
ln: target '/<>/debian/htslib-test/usr/share/htslib-test/cram/' is 
not a directory: No such file or directory
ln: target '/<>/debian/htslib-test/usr/share/htslib-test/cram/' is 
not a directory: No such file or directory
ln: target '/<>/debian/htslib-test/usr/share/htslib-test/cram/' is 
not a directory: No such file or directory
ln: target '/<>/debian/htslib-test/usr/share/htslib-test/cram/' is 
not a directory: No such file or directory
ln: target '/<>/debian/htslib-test/usr/share/htslib-test/cram/' is 
not a directory: No such file or directory
ln: target '/<>/debian/htslib-test/usr/share/htslib-test/cram/' is 
not a directory: No such file or directory
ln: target '/<>/debian/htslib-test/usr/share/htslib-test/cram/' is 
not a directory: No such file or directory
ln: target '/<>/debian/htslib-test/usr/share/htslib-test/cram/' is 
not a directory: No such file or directory
ln: target '/<>/debian/htslib-test/usr/share/htslib-test/cram/' is 
not a directory: No such file or directory
debian/rules:43: recipe for target 'override_dh_link' failed
make[1]: *** [override_dh_link] Error 1

Bug#864980: network-manager binary-all FTBFS: install: cannot create regular file 'debian/network-manager/etc/NetworkManager/dispatcher.d/01ifupdown': No such file or directory

[Adrian Bunk]

Source: network-manager
Version: 1.8.0-4
Severity: serious

https://buildd.debian.org/status/fetch.php?pkg=network-manager=all=1.8.0-4=1497750968=0

...
dh_install -X.la --list-missing
dh_install: usr/share/doc/NetworkManager/examples/server.conf exists in 
debian/tmp but is not installed to anywhere
install -m 755 debian/network-manager-dispatcher.script \
debian/network-manager/etc/NetworkManager/dispatcher.d/01ifupdown
install: cannot create regular file 
'debian/network-manager/etc/NetworkManager/dispatcher.d/01ifupdown': No such 
file or directory
debian/rules:55: recipe for target 'override_dh_install' failed
make[1]: *** [override_dh_install] Error 1

Bug#864974: thunderbird: Missing AtomicOperations for multiple architectures cause FTBFS

[John Paul Adrian Glaubitz]

Source: icedove
Version: 1:52.2.0-1
Severity: serious
Justification: fails to build from source

Hi!

thunderbird fails to build from source on multiple architectures,
including s390x, because the proper AtomicOperations header
is not included for the affected architectures.

Looking at [1], all architectures that do not have their own
variant of the AtomicOperations header must use the generic
ppc or sparc headers, e.g.

(...)
# elif defined(__alpha__)
#  include "jit/none/AtomicOperations-ppc.h"
# elif defined(__hppa__)
#  include "jit/none/AtomicOperations-ppc.h"
#elif defined(__m68k__)
#  include "jit/none/AtomicOperations-ppc.h"
#elif defined(__s390__)
#  include "jit/none/AtomicOperations-ppc.h"
#elif defined(__sh__)
#  include "jit/none/AtomicOperations-ppc.h"
(...)

From what I can see, you are currently missing:

alpha: __alpha__
hppa: __hppa__
m68k: __m68k__
powerpc and powerpcspe: __ppc__
s390: __s390__

ppc64 and sparc64 should work as they define "__PPC64__" and
"__sparc__" which is actually covered in the current code. I will
check what's wrong on this architectures later.

See also [2] (note: AtomicOperations-ppc.h and AtomicOperations-sparc.h
are identical and have been renamed to AtomicOperations-feeling-lucky.h
by upstream).

All architectures which are not including jit/none/AtomicOperations-ppc.h
or jit/none/AtomicOperations-sparc.h will include 
jit/none/AtomicOperations-none.h
and *will* FTBFS by definition (this is intended behavior in the JavaScript
engine). Please note that __sparc__ is also used for sparc64. So please
do not test for sparc64 with "#if defined(__sparc64__)", testing for
"__sparc__" is fine as it is.

Thus, please add the missing definitions for all architectures where the
build fails with:

Executing /«PKGBUILDDIR»/obj-thunderbird/dist/bin/xpcshell -g 
/«PKGBUILDDIR»/obj-thunderbird/dist/bin/ -a 
/«PKGBUILDDIR»/obj-thunderbird/dist/bin/ -f 
/«PKGBUILDDIR»/mozilla/toolkit/mozapps/installer/precompile_cache.js -e 
precompile_startupcache("resource://gre/");
d: file /«PKGBUILDDIR»/mozilla/xpcom/build/XPCOMInit.cpp, line 709
[23935] ###!!! ABORT: u_init() failed: file 
/«PKGBUILDDIR»/mozilla/xpcom/build/XPCOMInit.cpp, line 709
Traceback (most recent call last):
  File "/«PKGBUILDDIR»/mozilla/toolkit/mozapps/installer/packager.py", line 
415, in 
main()
  File "/«PKGBUILDDIR»/mozilla/toolkit/mozapps/installer/packager.py", line 
409, in main
args.source, gre_path, base)
  File "/«PKGBUILDDIR»/mozilla/toolkit/mozapps/installer/packager.py", line 
166, in precompile_cache
errors.fatal('Error while running startup cache precompilation')
  File "/«PKGBUILDDIR»/mozilla/python/mozbuild/mozpack/errors.py", line 103, in 
fatal
self._handle(self.FATAL, msg)
  File "/«PKGBUILDDIR»/mozilla/python/mozbuild/mozpack/errors.py", line 98, in 
_handle
raise ErrorMessage(msg)
mozpack.errors.ErrorMessage: Error: Error while running startup cache 
precompilation
/«PKGBUILDDIR»/mozilla/toolkit/mozapps/installer/packager.mk:41: recipe for 
target 'stage-package' failed
make[4]: *** [stage-package] Error 1

PS: The build logs for ppc64, sparc64 and x32 are currently missing due to 
issues on the
buildds with sending mail. We're working on fixing this.

Cheers,
Adrian

> [1] 
> https://anonscm.debian.org/cgit/pkg-mozilla/icedove.git/tree/mozilla/js/src/jit/AtomicOperations.h
> [2] 
> https://github.com/glaubitz/gecko-dev/blob/m68k/js/src/jit/AtomicOperations.h#L340

--
 .''`.  John Paul Adrian Glaubitz
: :' :  Debian Developer - glaub...@debian.org
`. `'   Freie Universitaet Berlin - glaub...@physik.fu-berlin.de
  `-GPG: 62FF 8A75 84E0 2956 9546  0006 7426 3B37 F5B5 F913

Bug#864974: thunderbird: Missing AtomicOperations for multiple architectures cause FTBFS

[John Paul Adrian Glaubitz]

On 06/18/2017 10:40 AM, John Paul Adrian Glaubitz wrote:
> powerpc and powerpcspe: __ppc__

Correction: powerpc and powerpcspe should actually be covered:

#elif defined(__ppc__) || defined(__PPC__)
# include "jit/none/AtomicOperations-ppc.h"

Not sure why the JavaScript engine crashes here though. I will have
to debug the crash.

Adrian

-- 
 .''`.  John Paul Adrian Glaubitz
: :' :  Debian Developer - glaub...@debian.org
`. `'   Freie Universitaet Berlin - glaub...@physik.fu-berlin.de
  `-GPG: 62FF 8A75 84E0 2956 9546  0006 7426 3B37 F5B5 F913

Bug#864947: [Parl-devel] Bug#864947: parl-desktop-world depends on cruft package firefox-esr-l10n-be

[peter green]

On 18/06/17 10:51, Jonas Smedegaard wrote:

Quoting peter green (2017-06-17 21:49:38)

Package: debian-parl
Severity: serious
Version: 1.9.10

parl-desktop-world depends on firefox-esr-l10n-be which is no longer
built by firefox-esr. I'm still trying to figure out where this is
coming from, I can't find any evidence of it in the source package but
rebuilding the binaries doesn't make it go away.

I do not see that relationship in version 1.9.10 of parl-desktop-world -
are you sure you are referring to that exact version of the package (not
e.g. some rebuild of the package from source)?

Yes, I am sure I am referring to the Debian version of the package. Just 
checked on the dd accessible archive mirror server to be sure.

plugwash@coccia:~$ dpkg-deb --info 
/srv/ftp.debian.org/mirror/pool/main/d/debian-parl/parl-desktop-world_1.9.10_all.deb
 | grep firefox-esr-l10n-be
 Depends: parl-desktop, aspell-en, aspell-eo, firefox-esr-l10n-ach, firefox-esr-l10n-af, firefox-esr-l10n-an, firefox-esr-l10n-ar, firefox-esr-l10n-as, firefox-esr-l10n-ast, firefox-esr-l10n-az, firefox-esr-l10n-be, firefox-esr-l10n-bg, firefox-esr-l10n-bn-bd, firefox-esr-l10n-bn-in, firefox-esr-l10n-br, firefox-esr-l10n-bs, firefox-esr-l10n-ca, firefox-esr-l10n-cs, firefox-esr-l10n-cy, firefox-esr-l10n-dsb, firefox-esr-l10n-el, firefox-esr-l10n-en-gb, firefox-esr-l10n-en-za, firefox-esr-l10n-eo, firefox-esr-l10n-es-ar, firefox-esr-l10n-es-cl, firefox-esr-l10n-es-es, firefox-esr-l10n-es-mx, firefox-esr-l10n-et, firefox-esr-l10n-eu, firefox-esr-l10n-fa, firefox-esr-l10n-ff, firefox-esr-l10n-fi, firefox-esr-l10n-fr, firefox-esr-l10n-fy-nl, firefox-esr-l10n-ga-ie, firefox-esr-l10n-gd, firefox-esr-l10n-gl, firefox-esr-l10n-gn, firefox-esr-l10n-gu-in, firefox-esr-l10n-he, firefox-esr-l10n-hi-in, firefox-esr-l10n-hr, firefox-esr-l10n-hsb, firefox-esr-l10n-hu, 
firefox-esr-l10n-hy-am, firefox-esr-l10n-id, firefox-esr-l10n-is, firefox-esr-l10n-it, firefox-esr-l10n-ja, firefox-esr-l10n-kk, firefox-esr-l10n-km, firefox-esr-l10n-kn, firefox-esr-l10n-ko, firefox-esr-l10n-lij, firefox-esr-l10n-lt, firefox-esr-l10n-lv, firefox-esr-l10n-mai, firefox-esr-l10n-mk, firefox-esr-l10n-ml, firefox-esr-l10n-mr, firefox-esr-l10n-ms, firefox-esr-l10n-nb-no, firefox-esr-l10n-nl, firefox-esr-l10n-nn-no, firefox-esr-l10n-or, firefox-esr-l10n-pa-in, firefox-esr-l10n-pl, firefox-esr-l10n-pt-br, firefox-esr-l10n-pt-pt, firefox-esr-l10n-rm, firefox-esr-l10n-ro, firefox-esr-l10n-ru, firefox-esr-l10n-si, firefox-esr-l10n-sk, firefox-esr-l10n-sl, firefox-esr-l10n-son, firefox-esr-l10n-sq, firefox-esr-l10n-sr, firefox-esr-l10n-sv-se, firefox-esr-l10n-ta, firefox-esr-l10n-te, firefox-esr-l10n-th, firefox-esr-l10n-tr, firefox-esr-l10n-uz, firefox-esr-l10n-vi, firefox-esr-l10n-xh, firefox-esr-l10n-zh-cn, firefox-esr-l10n-zh-tw, hunspell-af, hunspell-an, 
hunspell-ar, hunspell-be, hunspell-bn, hunspell-br, hunspell-bs, hunspell-de-at, hunspell-de-ch, hunspell-de-de, hunspell-en-au, hunspell-en-ca, hunspell-en-gb, hunspell-en-us, hunspell-en-za, hunspell-eu, hunspell-gd, hunspell-gl-es, hunspell-gu, hunspell-hi, hunspell-hr, hunspell-is, hunspell-it, hunspell-kk, hunspell-kmr, hunspell-ko, hunspell-lo, hunspell-lt, hunspell-ml, hunspell-ne, hunspell-oc, hunspell-ro, hunspell-se, hunspell-si, hunspell-sr, hunspell-sw, hunspell-te, hunspell-th, hunspell-uk, hunspell-uz, hunspell-vi, hyphen-af, hyphen-as, hyphen-bn, hyphen-da, hyphen-de, hyphen-en-gb, hyphen-en-us, hyphen-kn, hyphen-mr, hyphen-pa, hyphen-ta, hyphen-zu, iamerican, ibritish, ibulgarian, icatalan, icedove-bidiui, iczech, idanish, idutch, iesperanto, iestonian, ifaroese, ifrench, igaelic, igalician-minimos, ihungarian, iirish, iitalian, ilithuanian, imanx, ingerman, inorwegian, iogerman, ipolish, iportuguese, irussian, ispanish, iswedish, iswiss, itagalog, iukrainian, 
libreoffice-l10n-af, libreoffice-l10n-am, libreoffice-l10n-ar, libreoffice-l10n-as, libreoffice-l10n-ast, libreoffice-l10n-be, libreoffice-l10n-bg, libreoffice-l10n-bn, libreoffice-l10n-br, libreoffice-l10n-bs, libreoffice-l10n-ca, libreoffice-l10n-cs, libreoffice-l10n-cy, libreoffice-l10n-da, libreoffice-l10n-de, libreoffice-l10n-dz, libreoffice-l10n-el, libreoffice-l10n-en-gb, libreoffice-l10n-en-za, libreoffice-l10n-eo, libreoffice-l10n-es, libreoffice-l10n-et, libreoffice-l10n-eu, libreoffice-l10n-fa, libreoffice-l10n-fi, libreoffice-l10n-fr, libreoffice-l10n-ga, libreoffice-l10n-gl, libreoffice-l10n-gu, libreoffice-l10n-gug, libreoffice-l10n-he, libreoffice-l10n-hi, libreoffice-l10n-hr, libreoffice-l10n-hu, libreoffice-l10n-id, libreoffice-l10n-in, libreoffice-l10n-is, libreoffice-l10n-it, libreoffice-l10n-ja, libreoffice-l10n-ka, libreoffice-l10n-kk, libreoffice-l10n-km, libreoffice-l10n-kmr, libreoffice-l10n-ko, libreoffice-l10n-lt, libreoffice-l10n-lv, 
libreoffice-l10n-mk, libreoffice-l10n-ml, libreoffice-l10n-mn, libreoffice-l10n-mr, libreoffice-l10n-nb, libreoffice-l10n-ne, libreoffice-l10n-nl, libreoffice-l10n-nn, libreoffice-l10n-nr, 

Bug#864979: marked as done (htslib FTBFS: ln: target '/<>/debian/htslib-test/usr/share/htslib-test/cram/' is not a directory: No such file or directory)

[Debian Bug Tracking System]

Your message dated Sun, 18 Jun 2017 12:48:52 +
with message-id 
and subject line Bug#864979: fixed in htslib 1.4.1-2
has caused the Debian Bug report #864979,
regarding htslib FTBFS: ln: target 
'/<>/debian/htslib-test/usr/share/htslib-test/cram/' is not a 
directory: No such file or directory
to be marked as done.

This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.

(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)


-- 
864979: http://bugs.debian.org/cgi-bin/bugreport.cgi?bug=864979
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---
Source: htslib
Version: 1.4.1-1
Severity: serious

https://buildd.debian.org/status/package.php?p=htslib=sid

...
# provide header files as expected by the Makefile of the test suite via 
symlinks
for l in `ls debian/libhts-dev/usr/include/htslib/cram/*.h` ; do \
ln -s ../../../include/htslib/cram/`basename $l` 
/<>/debian/htslib-test/usr/share/htslib-test/cram/ ; \
done
ln: target '/<>/debian/htslib-test/usr/share/htslib-test/cram/' is 
not a directory: No such file or directory
ln: target '/<>/debian/htslib-test/usr/share/htslib-test/cram/' is 
not a directory: No such file or directory
ln: target '/<>/debian/htslib-test/usr/share/htslib-test/cram/' is 
not a directory: No such file or directory
ln: target '/<>/debian/htslib-test/usr/share/htslib-test/cram/' is 
not a directory: No such file or directory
ln: target '/<>/debian/htslib-test/usr/share/htslib-test/cram/' is 
not a directory: No such file or directory
ln: target '/<>/debian/htslib-test/usr/share/htslib-test/cram/' is 
not a directory: No such file or directory
ln: target '/<>/debian/htslib-test/usr/share/htslib-test/cram/' is 
not a directory: No such file or directory
ln: target '/<>/debian/htslib-test/usr/share/htslib-test/cram/' is 
not a directory: No such file or directory
ln: target '/<>/debian/htslib-test/usr/share/htslib-test/cram/' is 
not a directory: No such file or directory
ln: target '/<>/debian/htslib-test/usr/share/htslib-test/cram/' is 
not a directory: No such file or directory
ln: target '/<>/debian/htslib-test/usr/share/htslib-test/cram/' is 
not a directory: No such file or directory
ln: target '/<>/debian/htslib-test/usr/share/htslib-test/cram/' is 
not a directory: No such file or directory
ln: target '/<>/debian/htslib-test/usr/share/htslib-test/cram/' is 
not a directory: No such file or directory
ln: target '/<>/debian/htslib-test/usr/share/htslib-test/cram/' is 
not a directory: No such file or directory
ln: target '/<>/debian/htslib-test/usr/share/htslib-test/cram/' is 
not a directory: No such file or directory
ln: target '/<>/debian/htslib-test/usr/share/htslib-test/cram/' is 
not a directory: No such file or directory
ln: target '/<>/debian/htslib-test/usr/share/htslib-test/cram/' is 
not a directory: No such file or directory
ln: target '/<>/debian/htslib-test/usr/share/htslib-test/cram/' is 
not a directory: No such file or directory
ln: target '/<>/debian/htslib-test/usr/share/htslib-test/cram/' is 
not a directory: No such file or directory
ln: target '/<>/debian/htslib-test/usr/share/htslib-test/cram/' is 
not a directory: No such file or directory
debian/rules:43: recipe for target 'override_dh_link' failed
make[1]: *** [override_dh_link] Error 1
--- End Message ---
--- Begin Message ---
Source: htslib
Source-Version: 1.4.1-2

We believe that the bug you reported is fixed in the latest version of
htslib, which is due to be installed in the Debian FTP archive.

A summary of the changes between this version and the previous one is
attached.

Thank you for reporting the bug, which will now be closed.  If you
have further comments please address them to 864...@bugs.debian.org,
and the maintainer will reopen the bug report if appropriate.

Debian distribution maintenance software
pp.
Andreas Tille  (supplier of updated htslib package)

(This message was generated automatically at their request; if you
believe that there is a problem with it please contact the archive
administrators by mailing ftpmas...@ftp-master.debian.org)


-BEGIN PGP SIGNED MESSAGE-
Hash: SHA256

Format: 1.8
Date: Sun, 18 Jun 2017 14:19:22 +0200
Source: htslib
Binary: libhts2 libhts-dev htslib-test tabix
Architecture: source
Version: 1.4.1-2
Distribution: unstable
Urgency: medium
Maintainer: Debian Med Packaging Team 

Changed-By: Andreas Tille 
Description:
 htslib-test - Test data for HTSlib
 libhts-dev - Development files for the HTSlib
 libhts2- C library for high-throughput sequencing data formats
 tabix  - generic indexer for 

Bug#861958: marked as done (lintian: insecure YAML validation [CVE-2017-8829])

[Debian Bug Tracking System]

Your message dated Sun, 18 Jun 2017 09:18:53 +
with message-id 
and subject line Bug#861958: fixed in lintian 2.5.51
has caused the Debian Bug report #861958,
regarding lintian: insecure YAML validation [CVE-2017-8829]
to be marked as done.

This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.

(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)


-- 
861958: http://bugs.debian.org/cgi-bin/bugreport.cgi?bug=861958
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---

Package: lintian
Version: 2.5.41
Tags: security

Lintian uses the YAML::XS module to validate YAML in debian/upstream/metadata.
This module is happy to deserialize objects of any existing Perl class. For 
Lintian, the File::Temp::Dir class can be abused to remove arbitrary directory 
trees. (There might be other exciting ways to exploit this bug, but I'm too 
lazy to investigate further.)


I've attached proof-of-concept exploit:

$ mkdir /tmp/moo
$ ls -d /tmp/moo
/tmp/moo
$ lintian -C upstream-metadata badyaml_1.dsc
$ ls -d /tmp/moo
/bin/ls: cannot access '/tmp/moo': No such file or directory

--
Jakub Wilk


badyaml_1.tar.xz
Description: application/xz
Format: 3.0 (native)
Source: badyaml
Binary: badyaml
Architecture: all
Version: 1
Package-List:
 badyaml deb unknown unknown arch=all
Checksums-Sha1:
 9838fde8d6dd00bda20dc32ef430cc912e9f96d9 27928 badyaml_1.tar.xz
Checksums-Sha256:
 d06b616c490cceaffeadaeca19e19348e2cc223aa6e1feb27343932d4f75dbf6 27928 
badyaml_1.tar.xz
Files:
 936d4f8f7134f8b41c4f67b05dd7b3e0 27928 badyaml_1.tar.xz
--- End Message ---
--- Begin Message ---
Source: lintian
Source-Version: 2.5.51

We believe that the bug you reported is fixed in the latest version of
lintian, which is due to be installed in the Debian FTP archive.

A summary of the changes between this version and the previous one is
attached.

Thank you for reporting the bug, which will now be closed.  If you
have further comments please address them to 861...@bugs.debian.org,
and the maintainer will reopen the bug report if appropriate.

Debian distribution maintenance software
pp.
Niels Thykier  (supplier of updated lintian package)

(This message was generated automatically at their request; if you
believe that there is a problem with it please contact the archive
administrators by mailing ftpmas...@ftp-master.debian.org)


-BEGIN PGP SIGNED MESSAGE-
Hash: SHA256

Format: 1.8
Date: Sun, 18 Jun 2017 07:57:57 +
Source: lintian
Binary: lintian
Architecture: source
Version: 2.5.51
Distribution: unstable
Urgency: medium
Maintainer: Debian Lintian Maintainers 
Changed-By: Niels Thykier 
Description:
 lintian- Debian package checker
Closes: 540294 633850 645455 695345 698723 814521 815233 829649 848878 849470 
849880 851215 852005 852084 852145 852369 852404 852407 852409 852410 852411 
852413 852414 852416 852419 852421 852426 852891 854132 855243 856155 856312 
856857 856954 856975 857194 857654 857655 857656 858117 858326 859412 859467 
860419 860558 861509 861599 861958 863020 863386
Changes:
 lintian (2.5.51) unstable; urgency=medium
 .
   * Summary of tag changes:
 + Added:
   - debian-control-has-dbgsym-package
   - debian-control-has-obsolete-dbg-package
   - debian-rules-parses-dpkg-parsechangelog
   - desktop-entry-lacks-icon-entry
   - distribution-and-changes-mismatch
   - distribution-and-experimental-mismatch
   - gir-in-arch-all-package
   - gir-missing-typelib-dependency
   - gir-section-not-libdevel
   - multiarch-foreign-shared-library
   - r-data-without-readme-source
   - readme-source-is-dh_make-template
   - repeated-trigger-name
   - systemd-service-file-refers-to-obsolete-bindto
   - testsuite-autopkgtest-missing
   - typelib-in-arch-all-package
   - typelib-missing-gir-depends
   - typelib-not-in-multiarch-directory
   - typelib-package-name-does-not-match
   - typelib-section-not-introspection
   - unknown-trigger
   - unreleased-changes
   - uses-implicit-await-trigger
 + Removed:
   - ancient-autotools-helper-file
   - init.d-script-missing-dependency-on-remote_fs
   - maintainer-script-should-not-use-ancient-dpkg-epoch-check
   - maintainer-script-should-not-use-ancient-dpkg-multi-conrep-check
   - outdated-autotools-helper-file
   - package-would-benefit-from-build-arch-targets
   - suidregister-used-in-maintainer-script
 .
   * checks/binaries.{desc,pm}:
 + [NT] Apply patch from Adrian Bunk to bump severity of the
   hardening-no-pie to a W-tag and 

Bug#863020: marked as done (lintian: FTBFS: test failures)

[Debian Bug Tracking System]

Your message dated Sun, 18 Jun 2017 09:18:53 +
with message-id 
and subject line Bug#863020: fixed in lintian 2.5.51
has caused the Debian Bug report #863020,
regarding lintian: FTBFS: test failures
to be marked as done.

This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.

(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)


-- 
863020: http://bugs.debian.org/cgi-bin/bugreport.cgi?bug=863020
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---
Package: lintian
Version: 2.5.50.3
Severity: serious
User: debian-p...@lists.debian.org
Usertags: bcn2017

This package fails to build from source on current sid.

Looking at ci.debian.net, this was probably caused by the recent
dpkg_1.18.24 upload.

Greetings from the Debian Perl Sprint / Suncamp in Lloret de Mar :)

tests::cruft-general-diff: diff -u t/tests/cruft-general-diff/tags 
/<>/debian/test-out/tests/cruft-general-diff/tags.cruft-general-diff
--- t/tests/cruft-general-diff/tags 2013-01-20 22:12:29.0 +
+++ 
/<>/debian/test-out/tests/cruft-general-diff/tags.cruft-general-diff
   2017-05-20 08:24:20.105874092 +
@@ -1,4 +1,3 @@
-E: cruft-general-diff source: debian-files-list-in-source
 E: cruft-general-diff source: diff-contains-cmake-cache-file CMakeCache.txt
 W: cruft-general-diff source: diff-contains-arch-control-dir {arch}
 W: cruft-general-diff source: diff-contains-arch-inventory-file .arch-inventory
fail tests::cruft-general-diff: output differs!
.

[...]

Failed tests (4)
tests::cruft-general-diff
tests::cruft-general-native
tests::cruft-general-quilt
tests::cruft-general-wig-pen
debian/rules:48: recipe for target 'runtests' failed
make[1]: *** [runtests] Error 1

-- 
Niko Tyni   nt...@debian.org
--- End Message ---
--- Begin Message ---
Source: lintian
Source-Version: 2.5.51

We believe that the bug you reported is fixed in the latest version of
lintian, which is due to be installed in the Debian FTP archive.

A summary of the changes between this version and the previous one is
attached.

Thank you for reporting the bug, which will now be closed.  If you
have further comments please address them to 863...@bugs.debian.org,
and the maintainer will reopen the bug report if appropriate.

Debian distribution maintenance software
pp.
Niels Thykier  (supplier of updated lintian package)

(This message was generated automatically at their request; if you
believe that there is a problem with it please contact the archive
administrators by mailing ftpmas...@ftp-master.debian.org)


-BEGIN PGP SIGNED MESSAGE-
Hash: SHA256

Format: 1.8
Date: Sun, 18 Jun 2017 07:57:57 +
Source: lintian
Binary: lintian
Architecture: source
Version: 2.5.51
Distribution: unstable
Urgency: medium
Maintainer: Debian Lintian Maintainers 
Changed-By: Niels Thykier 
Description:
 lintian- Debian package checker
Closes: 540294 633850 645455 695345 698723 814521 815233 829649 848878 849470 
849880 851215 852005 852084 852145 852369 852404 852407 852409 852410 852411 
852413 852414 852416 852419 852421 852426 852891 854132 855243 856155 856312 
856857 856954 856975 857194 857654 857655 857656 858117 858326 859412 859467 
860419 860558 861509 861599 861958 863020 863386
Changes:
 lintian (2.5.51) unstable; urgency=medium
 .
   * Summary of tag changes:
 + Added:
   - debian-control-has-dbgsym-package
   - debian-control-has-obsolete-dbg-package
   - debian-rules-parses-dpkg-parsechangelog
   - desktop-entry-lacks-icon-entry
   - distribution-and-changes-mismatch
   - distribution-and-experimental-mismatch
   - gir-in-arch-all-package
   - gir-missing-typelib-dependency
   - gir-section-not-libdevel
   - multiarch-foreign-shared-library
   - r-data-without-readme-source
   - readme-source-is-dh_make-template
   - repeated-trigger-name
   - systemd-service-file-refers-to-obsolete-bindto
   - testsuite-autopkgtest-missing
   - typelib-in-arch-all-package
   - typelib-missing-gir-depends
   - typelib-not-in-multiarch-directory
   - typelib-package-name-does-not-match
   - typelib-section-not-introspection
   - unknown-trigger
   - unreleased-changes
   - uses-implicit-await-trigger
 + Removed:
   - ancient-autotools-helper-file
   - init.d-script-missing-dependency-on-remote_fs
   - maintainer-script-should-not-use-ancient-dpkg-epoch-check
   - maintainer-script-should-not-use-ancient-dpkg-multi-conrep-check
   - outdated-autotools-helper-file
   - 

Processed: Re: parl-desktop-world depends on cruft package firefox-esr-l10n-be

[Debian Bug Tracking System]

Processing commands for cont...@bugs.debian.org:

> Tags 864947 +patch
Bug #864947 [debian-parl] parl-desktop-world depends on cruft package 
firefox-esr-l10n-be
Added tag(s) patch.
> Thanks
Stopping processing here.

Please contact me if you need assistance.
-- 
864947: http://bugs.debian.org/cgi-bin/bugreport.cgi?bug=864947
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems

Bug#864947: parl-desktop-world depends on cruft package firefox-esr-l10n-be

[peter green]

Tags 864947 +patch
Thanks


parl-desktop-world depends on firefox-esr-l10n-be which is no longer built by 
firefox-esr. I'm still trying to figure out where this is coming from, I can't 
find any evidence of it in the source package but rebuilding the binaries 
doesn't make it go away.


Ok, figured it out, the reference comes from boxer-data

So to fix this bug requires an update to boxer-data followed by a (sourceful) 
rebuild of debian-parl. Patch for boxer-data is at 
http://debdiffs.raspbian.org/main/b/boxer-data/boxer-data_10.5.20%2brpi1.debdiff
 , once I have confirmed this mail is in the buglog I will clone/block.

Processed: Clone bug

[Debian Bug Tracking System]

Processing commands for cont...@bugs.debian.org:

> clone 864947 -1
Bug #864947 [debian-parl] parl-desktop-world depends on cruft package 
firefox-esr-l10n-be
Bug 864947 cloned as bug 864985
> reassign -1 boxer-data
Bug #864985 [debian-parl] parl-desktop-world depends on cruft package 
firefox-esr-l10n-be
Bug reassigned from package 'debian-parl' to 'boxer-data'.
No longer marked as found in versions 1.9.10.
Ignoring request to alter fixed versions of bug #864985 to the same values 
previously set
> block 864947 by -1
Bug #864947 [debian-parl] parl-desktop-world depends on cruft package 
firefox-esr-l10n-be
864947 was not blocked by any bugs.
864947 was not blocking any bugs.
Added blocking bug(s) of 864947: 864985
> retitle -1 boxer-data references cruft package firefox-esr-l10n-be
Bug #864985 [boxer-data] parl-desktop-world depends on cruft package 
firefox-esr-l10n-be
Changed Bug title to 'boxer-data references cruft package firefox-esr-l10n-be' 
from 'parl-desktop-world depends on cruft package firefox-esr-l10n-be'.
> thanks
Stopping processing here.

Please contact me if you need assistance.
-- 
864947: http://bugs.debian.org/cgi-bin/bugreport.cgi?bug=864947
864985: http://bugs.debian.org/cgi-bin/bugreport.cgi?bug=864985
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems