Re: Autopkgtests for pilercr

On Fri, Jun 18, 2021 at 01:45:13AM +0530, Nilesh Patra wrote: > > > > $ efetch -db nuccore -id CP014688.1 -format fasta | head -n175 > > >CP014688.1 Acetobacter persici strain TMW2.1084 plasmid pAC1084_1, > > complete sequence > > ACGAGGTCGTTTCTGTCGACCCGCTGGCTATATTCAGGCTGGTAGATGTCGGCGTGGTCT

Re: Autopkgtests for pilercr

Dear Shruti, On Thu, Jun 17, 2021 at 09:06:14PM +0530, Shruti Sridhar wrote: > I'm extremely sorry for all the confusion and I will be more > careful from now on. There is no need to apologize from your side. Its our task as mentors to point this kind of things out and you are in a learning proc

Re: Autopkgtests for pilercr

On 17/06/21 03:45 PM, Aaron M. Ucko wrote: > Nilesh Patra writes: > > > Since fetching it directly from a file location or a sort of API doesn't > > seem the way out, writing a script directly looks not easy. > > Programmatic retrieval is very much possible, via ncbi-entrez-direct: > > $ efe

Re: Autopkgtests for pilercr

Nilesh Patra writes: > Since fetching it directly from a file location or a sort of API doesn't seem > the way out, writing a script directly looks not easy. Programmatic retrieval is very much possible, via ncbi-entrez-direct: $ efetch -db nuccore -id CP014688.1 -format fasta | head -n175

Re: Autopkgtests for pilercr

Hi Shruti, On 6/17/21 9:06 PM, Shruti Sridhar wrote: > I had originally taken the data from the examples on the website [1] and I > thought that the same data would be available on their github repository.  > > But since the data is not the same, I have now changed it to the same > sequence fro

Re: Autopkgtests for pilercr

I had originally taken the data from the examples on the website [1] and I thought that the same data would be available on their github repository. But since the data is not the same, I have now changed it to the same sequence from the NCBI database [2] so I have added the public domain license f

Re: Autopkgtests for pilercr

Andrius Merkys writes: > investigate which license is appropriate for NCBI Nucleotide database. Normally public domain, as with NCBI software. There have been occasional (apparent?) exceptions, as notably found within the UniVec data I had to drop from ncbi-tools6 a couple of years ago, but I s

Re: Autopkgtests for pilercr

Hello, On 2021-06-17 09:42, Shruti Sridhar wrote: > The fasta files that I used are present as their examples.  > It can also be found on their repository here - > (https://github.com/dcouvin/CRISPRCasFinder/blob/master/install_test/sequence.fasta >

Re: Autopkgtests for pilercr

On Thu, Jun 17, 2021 at 12:46:14PM +0530, Nilesh Patra wrote: > > I modified this file a little for the test. Is this alright or do I change > > the dataset that I used? > > There are 7518 lines in that file, while your test data has just 120. Did you > copy parts off the file you mentioned? > I

Re: Autopkgtests for pilercr

On 6/17/21 12:12 PM, Shruti Sridhar wrote: > Hi,  > > The fasta files that I used are present as their examples.  > It can also be found on their repository here - > (https://github.com/dcouvin/CRISPRCasFinder/blob/master/install_test/sequence.fasta) > > I modified this file a little for the t

Re: Autopkgtests for pilercr

Hi, The fasta files that I used are present as their examples. It can also be found on their repository here - ( https://github.com/dcouvin/CRISPRCasFinder/blob/master/install_test/sequence.fasta ) I modified this file a little for the test. Is this alright or do I change the dataset that I used?

Re: Autopkgtests for pilercr

Hi, On 6/15/21 8:00 PM, Shruti Sridhar wrote: > Hi,  > > I have written autopkgtests for pilercr  > (https://salsa.debian.org/med-team/pilercr) Excuse my lack of understanding, but the page you mentioned in d/README.test is https://crisprcas.i2bc.paris-saclay.fr/CrisprCasFind

Autopkgtests for pilercr

Hi, I have written autopkgtests for pilercr ( https://salsa.debian.org/med-team/pilercr) Kindly review, Thanks! Regards Shruti ᐧ