On Monday, 3 December 2018 at 06:09:21 UTC, Joel wrote:
I can't seem to get this to work!
```
foreach(line; File("help.txt").byLine) {
writeln(line.stripLeft);
```
With the code above, I get this compile error:
source/app.d(360,36): Error: template
std.algorithm.mutation.stripLeft cannot d
On Friday, 14 December 2018 at 12:43:40 UTC, berni wrote:
I've got a lot of code with two-dimensional arrays, where I use
stuff like:
assert(matrix.all!(a=>a.all!(b=>b>=0)));
Does anyone know if there is a 2D-version of all so I can write
something like:
assert(matrix.all2D!(a=>a>=0));
On Saturday, 22 December 2018 at 03:44:09 UTC, Timoses wrote:
On Wednesday, 19 December 2018 at 15:40:50 UTC, Neia Neutuladh
wrote:
On Wed, 19 Dec 2018 15:12:14 +, bauss wrote:
Or while instantiating it:
mixin template foo()
{
int _ignoreme()
{
if (readln.strip == "abort") throw new
On Thursday, 3 January 2019 at 06:25:46 UTC, Russel Winder wrote:
So I have a D program that used to work. I come back to it,
recompile it, and:
[...]
__GI___libc_free (mem=0xa) at malloc.c:3093
You've tried to free a pointer that, while not null, was derived
from a pointer that was, i.e.
On Thursday, 3 January 2019 at 08:35:17 UTC, Russel Winder wrote:
Sorry about that, fairly obvious that the backtrace is needed
in hindsight. :- )
#0 __GI___libc_free (mem=0xa) at malloc.c:3093
#1 0x5558f174 in dvb_file_free
(dvb_file=0x555a1320) at dvb_file.d:282
#2 0x5
On Saturday, 5 January 2019 at 07:34:17 UTC, Russel Winder wrote:
TransmitterData has a destructor defined but with no code in
it. This used to work fine – but I cannot be certain which
version of LDC that was.
The problem does seem to be in the construction of the
TransmitterData object beca
On Saturday, 5 January 2019 at 10:52:48 UTC, Russel Winder wrote:
I found the problem and then two minutes later read your email
and bingo we have found the problem.
Well done.
Previously I had used File_Ptr* and on this occasion I was
using File_Ptr and there was no copy constructor because
On Saturday, 5 January 2019 at 12:14:15 UTC, Russel Winder wrote:
Indeed. I should do that to see if I can reproduce the problem
to submit a proper bug report.
File_Ptr is wrapping a dvb_file * from libdvbv5 to try and make
things a bit for D and to ensure RAII. libdvbv5 is a C API with
class
On Saturday, 5 January 2019 at 13:01:24 UTC, Russel Winder wrote:
Dub seems to have the inbuilt assumption that libraries are
dependencies that do not change except via a formal release
when you developing an application. Clearly there is the
workflow where you want to amend the library but not
On Tuesday, 8 January 2019 at 10:23:30 UTC, Russel Winder wrote:
Actually that is not a worry since the TransmitterData instance
is only needed to call the scan function which creates a
ChannelsData instance that holds no references to the
TransmitterData instance.
It turns out that whilst th
On Wednesday, 9 January 2019 at 16:48:47 UTC, Russel Winder wrote:
It really is totally weird. My new Rust binding to libdvbv5 and
associated version of the same application works fine. So
libdvbv5 itself is not the cuprit. This has to mean it is
something about the D compilers that has changed
On Friday, 18 January 2019 at 12:27:17 UTC, Michael wrote:
Hello all,
I am getting this deprecation warning when compiling using
DMD64 D Compiler v2.084.0 on Linux. I'm a little unsure what
the problem is, however, because the code producing these
warnings tends to be of the form:
foreach
On Tuesday, 22 January 2019 at 14:13:23 UTC, Johan Engelen wrote:
The following code compiles:
```
alias T = shared(int)*;
shared T a;
shared T b;
shared T c;
void foo() {
import core.atomic: cas;
cas(&a, b, c);
}
```
The type of T has to be a pointer to a shared int (you get a
templa
On Monday, 28 January 2019 at 11:37:56 UTC, Dukc wrote:
I have recenty updated my LDC to the most recent version
(1.14). The problem is that it compiles to LLVM code version
7.0.1, but I need it to compile to LLVM 6.x.x or LLVM 5.x.x.
The last release note said that LLVM versions from
3.someth
On Monday, 25 February 2019 at 06:51:20 UTC, Yevano wrote:
I am writing a domain specific language of sorts in D for the
lambda calculus. One of my requirements is that I should be
able to generate expressions like this:
new Abstraction(v1, M)
like this:
L!(x => M)
It is common to want to w
On Monday, 25 February 2019 at 02:49:36 UTC, James Blachly wrote:
Any ideas why DMD2 cannot inline this, but LDC2 has no problem
doing so -- or suggestions for what I can do to make DMD2
inline it?
Alternatively, I could version(DigitalMars) and version(LDC),
but AFAICT this requires me to du
On Monday, 25 February 2019 at 04:08:38 UTC, Jonathan M Davis
wrote:
One issue that's commonly brought up about dmd's inliner is
that it's in the front-end, which apparently is a poor way to
do inlining. One side effect of that though would be that
unless the ldc folks go to extra effort to dis
On Wednesday, 27 February 2019 at 05:45:19 UTC, Michelle Long
wrote:
Basically
void foo(int k = 20)()
{
static if (k <= 0 || k >= 100) return;
foo!(k-1)();
}
Error Error: template instance `foo!-280` recursive expansion
Yep, that return is a dynamic return, not a stat
On Wednesday, 27 February 2019 at 22:56:14 UTC, Michelle Long
wrote:
Trying to get dcompute to work... after a bunch of issues
dealing with all the crap this is what I can't get past:
Error: unrecognized `pragma(LDC_intrinsic)
This is actually from the ldc.intrinsics file, which I had to
rena
On Thursday, 28 February 2019 at 03:33:25 UTC, Sam Johnson wrote:
```
string snappyCompress(const string plaintext) {
import deimos.snappy.snappy : snappy_compress,
snappy_max_compressed_length, SNAPPY_OK;
import core.stdc.stdlib : malloc, free;
import std.string : fromStringz,
On Thursday, 28 February 2019 at 09:58:35 UTC, Michelle Long
wrote:
I've included it in Visual D as di and it seems not to add it
to the include line...
Is it in any way possible that it being an di file would allow
that? Seems that it is an LDC issue though but LDC has some
usage of it I bel
On Friday, 8 March 2019 at 09:24:25 UTC, Vasyl Teliman wrote:
I've tried to use Mallocator in BetterC but it seems it's not
available there:
https://run.dlang.io/is/pp3HDq
This produces a linker error.
I'm wondering why Mallocator is not available in this mode (it
would be intuitive to assum
On Saturday, 9 March 2019 at 12:42:34 UTC, Sebastiaan Koppe wrote:
There might also be the option to use @nogc exceptions (dip
1008), but I am not sure.
That won't work as the implementation on DIP1008 cheats the type
system but doesn't actually work, i.e. the exceptions are still
CG allocate
On Tuesday, 12 March 2019 at 05:14:21 UTC, Victor Porton wrote:
Why does this not compile?
import std.typecons;
template FieldInfo(T, Nullable!T default_) {
}
/usr/lib/ldc/x86_64-linux-gnu/include/d/std/typecons.d(2570,17): Error: `alias
T = T;` cannot alias itself, use a qualified name to cr
On Wednesday, 27 March 2019 at 06:55:53 UTC, Andrew Edwards wrote:
Good day all,
I've installed Gtk+ and GtkD on my MacBookPro which is running
macOS Mojave but am having some issues linking to and using it.
Any assistance to resolve this is appreciated.
Steps taken:
1. Install Gtk+
On Friday, 5 April 2019 at 14:47:42 UTC, Sjoerd Nijboer wrote:
So the following code doesn't compile for some reason, and I
can't figure out why.
enum MyEnum { A, B, C }
class MyClass(MyEnum myEnum)
{
/*...*/
}
int main()
{
MyClass!MyEnum.A a;
}
The error: Error: template instan
On Saturday, 6 April 2019 at 17:30:45 UTC, Mek101 wrote:
I'm rewriting from C# a small library of mine to practice with
D.
I have a class:
class WeightedRandom(T, W = float) if(isNumeric!W)
{
// Fields
private W[T] _pairs;
// The total sum of all the weights;
On Sunday, 7 April 2019 at 05:24:38 UTC, Alex wrote:
Error: template instance `Reflect!(type)` cannot use local
`type` as parameter to non-global template `Reflect(Ts...)()`
mixin(`import `~moduleName!(T)~`;`);
mixin(`alias X = T.`~name~`;`);
super.Reflect!(X);
I realize X
How do you pass a delegate to a c++ function to be called by it?
The function to pass the delegate to is:
extern (C++) int
fakeEntrypoint(
extern(C++) void function(void* /*delegate's context*/) func,
void* /*delegate's context*/ arg);
What I want is:
int entrypoint(scope void delegat
On Saturday, 4 May 2019 at 15:18:58 UTC, Random D user wrote:
I wanted to make a 2D array like structure and support D slice
like operations,
but I had surprisingly bad experience.
I quickly copy pasted the example from the docs:
https://dlang.org/spec/operatoroverloading.html#array-ops
It's
On Sunday, 5 May 2019 at 19:18:47 UTC, lithium iodate wrote:
On Sunday, 5 May 2019 at 18:53:08 UTC, Russel Winder wrote:
Hi,
I had merrily asumed I could implement nth Fibonacci number
with:
takeOne(drop(recurrence!((a, n) => a[n-1] + a[n-2])(zero,
one), n)).front
where zero and one a
On Sunday, 12 May 2019 at 20:06:34 UTC, torea wrote:
Hi,
I'd like to use D for the "brain" of a small robot (Anki
vector) whose API is coded in Python 3.6+.
I had a look at Pyd but it's limited to python 2.7...
It isn't. You may needs to set a dub version, or it may pick up
the 2.7 as the d
On Wednesday, 19 June 2019 at 19:25:59 UTC, Jonathan M Davis
wrote:
Aside from looking through the newsgroup/forum for discussions
on DIPs, that's pretty much all you're going to find on that.
Andrei's talk is the most up-to-date information that we have
about this particular DIP.
The prel
On Wednesday, 26 June 2019 at 13:57:22 UTC, Gilbert Fernandes
wrote:
I am using VS 2019 into which I have C# and C++ active.
Installed the following : DMD 2.086.1 then Visual D 0.50.0
DMD has been installed at the base of C:\ at C:\D
Created a D project, which contains a default Hello world
pro
On Wednesday, 3 July 2019 at 20:49:20 UTC, JN wrote:
Does anyone know if and how well D works on ARM laptops (such
as Chromebooks and similar)?
For example this one https://www.pine64.org/pinebook/ . Can it
compile D? Obviously DMD is out because it doesn't have ARM
builds. Not sure about GDC
On Monday, 15 July 2019 at 22:01:25 UTC, KytoDragon wrote:
I am currently trying to write a XAudio2 backend and have come
across the problem, that some of the interfaces for XAudio2's
COM objects seem to be missing the first entry in their vtable.
After reading the iterface article in the spec
On Saturday, 1 July 2017 at 20:47:55 UTC, Damien Gibson wrote:
Well I finally somehow got it to stop complaining about a bad
lib file, but now it wants to tell me the entry point for the
functions i list isnt correct, so now im just unsure if its
being stupid on me or im not writing something w
On Saturday, 1 July 2017 at 19:23:57 UTC, Void-995 wrote:
On Saturday, 1 July 2017 at 19:16:12 UTC, drug wrote:
01.07.2017 22:07, Void-995 пишет:
(Void-995) Hi, everyone. I'm pretty excited with what have D
to offer for game development, especially meta programming,
traits, object.factory, sig
On Sunday, 2 July 2017 at 00:49:30 UTC, LeqxLeqx wrote:
Hello!
How does one go about invoking a templated-variatic function
such as std.string.format
with an array of objects?
For example:
string stringMyThing (string formatForMyThings, MyThing[]
myThings)
{
return format(
formatForM
On Sunday, 2 July 2017 at 05:33:45 UTC, Damien Gibson wrote:
K im retarded... So I forgot the golden rule, debug libs with
debug app, release libs with release app.. I attempted loading
the debug version of dll with D again just to see what kinda
errors (may) come up there, sure enough there is
On Tuesday, 4 July 2017 at 23:27:25 UTC, Jean-Louis Leroy wrote:
I want to create a range that consists of the result of a map()
followed by a value, e.g.:
int[] x = [ 1, 2, 3];
auto y = map!(x => x * x)(x);
auto z = y ~ 99; // how???
I have tried several variations: convert 99 to a dyna
Why does this:
enum AddrSpace {
Global,Shared
}
struct Pointer(AddrSpace as, T)
{
T* ptr;
alias ptr this;
}
struct AutoIndexed(T) if (is(T : Pointer!(n,U),AddrSpace n,U))
{
T p;
private @property auto idx()
{
static if (n == AddrSpace.Global)
return G
Ignore, I was trying to analyse an uninstantiated template.
My library is generating a typeid from somewhere.
e.g.
typeid(const(Pointer!(cast(AddrSpace)1u, float)))
but I have never declared a const of that type nor have I used
typeid explicitly in my program. Where is this coming from?
The program is just:
enum AddrSpace {
Global,
Shared
}
st
On Friday, 7 July 2017 at 08:49:58 UTC, Nicholas Wilson wrote:
My library is generating a typeid from somewhere.
e.g.
typeid(const(Pointer!(cast(AddrSpace)1u, float)))
[...]
It seems to be coming from the need to hash the type, goodness
knows why, which explains why I only get the const varie
On Saturday, 8 July 2017 at 05:36:49 UTC, rikki cattermole wrote:
On 08/07/2017 2:35 AM, Nicholas Wilson wrote:
On Friday, 7 July 2017 at 08:49:58 UTC, Nicholas Wilson wrote:
My library is generating a typeid from somewhere.
e.g.
typeid(const(Pointer!(cast(AddrSpace)1u, float)))
[...]
It see
On Saturday, 8 July 2017 at 08:56:17 UTC, Rainer Schuetze wrote:
On 08.07.2017 07:55, Nicholas Wilson wrote:
On Saturday, 8 July 2017 at 05:36:49 UTC, rikki cattermole
wrote:
On 08/07/2017 2:35 AM, Nicholas Wilson wrote:
On Friday, 7 July 2017 at 08:49:58 UTC, Nicholas Wilson
wrote:
My libr
On Wednesday, 12 July 2017 at 12:20:11 UTC, Miguel L wrote:
What is the best way in D to create a function that receives a
static array of any length?
Do know that static arrays are passed by value in D, so passing a
static array of a million elements will copy them...
There are two solution
On Thursday, 13 July 2017 at 01:15:46 UTC, FoxyBrown wrote:
Everything I do results in some problem, I've tried malloc but
then converting the strings resulted in my program becoming
corrupted.
Heres the code:
auto EnumServices()
{
auto schSCManager = OpenSCManager(null, null,
SC_MANAG
On Friday, 14 July 2017 at 00:40:38 UTC, FoxyBrown wrote:
Anyone have an efficient implementation that is easy to use?
If you are OK with just a range spanning the two or more strings,
then you could use chain as is.
On Saturday, 15 July 2017 at 13:45:40 UTC, Morimur55 wrote:
On Saturday, 15 July 2017 at 13:12:49 UTC, Adam D. Ruppe wrote:
On Saturday, 15 July 2017 at 13:02:52 UTC, Morimur55 wrote:
[...]
The `typeid(obj)` will give the type... but why do you need
it? The classinfo returned by that doesn't
On Sunday, 16 July 2017 at 10:37:39 UTC, kerdemdemir wrote:
My goal is to find connected components in a 2D array for
example finding connected '*'
chars below.
x x x x x x
x x x x x x
x x * * x x
x x * * x x
x x x * * x
* x x x x x
There are two connected
On Tuesday, 18 July 2017 at 02:21:59 UTC, Enjoys Math wrote:
DMD32 D Compiler v2.074.1
import std.file;
void main() {
string bigInput = readText("input.txt");
}
The file is 7 MB of ascii text, don't know if that matters...
Should I upgrade versions?
I wonder if it thinks there is a BOM
On Monday, 17 July 2017 at 11:07:35 UTC, Anton Fediushin wrote:
Hello! What is the best way of rewriting this code in idiomatic
D manner?
--
foreach(a; ["foo", "bar"]) {
foreach(b; ["baz", "foz", "bof"]) {
foreach(c; ["FOO", "BAR"]) {
// Some operations on a, b and c
}
}
}
On Wednesday, 19 July 2017 at 07:29:55 UTC, Andrew Edwards wrote:
Given a module (somepackage.somemodule) how does one
programmatically determine the symbols contained therein and
associated UDAs?
Where symbol is a variable, function, UDT, etc... is this
possible?
foreach (symbol; somep
Im probably missing something really obvious but
Error: module dcompute.driver.ocl120 from file
source/dcompute/driver/ocl120/packge.d conflicts with package
name ocl120
the package.d file in question
```
module dcompute.driver.ocl120;
public import dcompute.driver.error;
public import dco
On Thursday, 20 July 2017 at 04:38:40 UTC, Adam D. Ruppe wrote:
On Thursday, 20 July 2017 at 04:33:55 UTC, Nicholas Wilson
wrote:
Error: module dcompute.driver.ocl120 from file
source/dcompute/driver/ocl120/packge.d conflicts with package
Is that a copy/paste error or did you actually misspel
On Friday, 21 July 2017 at 23:38:51 UTC, FoxyBrown wrote:
On Friday, 21 July 2017 at 22:35:20 UTC, Era Scarecrow wrote:
On Friday, 21 July 2017 at 21:03:22 UTC, FoxyBrown wrote:
Is there a way to easily find the differences between to
struct instances? I would like to report only the difference
On Tuesday, 25 July 2017 at 21:06:25 UTC, unDEFER wrote:
I have found the answer in the code.
Right code is:
Import imp = m.isImport();
if (imp !is null)
Thank you.
grep for kluge in code, you'll find all the places it does its
own RTTI.
On Thursday, 27 July 2017 at 21:33:29 UTC, James Dean wrote:
I'm interested in trying it out, says it's just for ldc. Can we
simply compile it using ldc then import it and use dmd, ldc, or
gdc afterwards?
The ability to write kernels is limited to LDC, though there is
no practical reason that
On Friday, 28 July 2017 at 00:39:43 UTC, James Dean wrote:
On Friday, 28 July 2017 at 00:23:35 UTC, Nicholas Wilson wrote:
On Thursday, 27 July 2017 at 21:33:29 UTC, James Dean wrote:
I'm interested in trying it out, says it's just for ldc. Can
we simply compile it using ldc then import it and
Hi
I want to replace each occurrence of a particular type in an
AliasSeq with a type from another AliasSeq (the both have the
same length) with the corresponding index
i.e. (int long long float) (byte char double dchar) replacing
long should yield (int char double float) std.meta.Replace wo
On Friday, 28 July 2017 at 22:06:27 UTC, Ali Çehreli wrote:
I think it works:
template replace(T) {
template inside(Src...) {
template from(Dst...) {
import std.meta;
enum f = staticIndexOf!(T, Src);
static if (f == -1) {
alias from
On Saturday, 29 July 2017 at 22:45:12 UTC, piotrekg2 wrote:
On Saturday, 29 July 2017 at 18:19:47 UTC, Johan Engelen wrote:
On Saturday, 29 July 2017 at 16:01:07 UTC, piotrekg2 wrote:
Hi,
I'm trying to port some of my c++ code which uses sse2
instructions into D. The code calls the following i
On Sunday, 30 July 2017 at 02:05:32 UTC, Nicholas Wilson wrote:
On Saturday, 29 July 2017 at 22:45:12 UTC, piotrekg2 wrote:
What about __builtin_ctz?
https://github.com/ldc-developers/druntime/blob/ldc/src/ldc/intrinsics.di#L325
you can also make it out of bsf or bsr (i can't remember which)
On Sunday, 6 August 2017 at 19:56:06 UTC, Johnson Jones wrote:
is it possible to do? I would like to pre-configure some stuff
at "pre-compilation"(in ctfe but before the rest of the program
actually gets compiled).
I know it's not safe and all that but in my specific case it
would help. I'll
On Sunday, 6 August 2017 at 23:33:26 UTC, greatsam4sure wrote:
import std.math;
import std.stdio;
cos(90*PI/180) = -2.7e-20 instead of zero. I will appreciate
any help. thanks in advance.
tan(90*PI/180) = -3.689e+19 instead of infinity. What is the
best way to use this module
in addition t
On Monday, 14 August 2017 at 00:44:05 UTC, WhatMeForget wrote:
module block_template;
void main()
{
template BluePrint(T, U)
{
T integer;
U floatingPoint;
}
BluePrint!(int, float);
}
// DMD returns
// template.d(13): Error: BluePrint!(int, float) has no effect
On Saturday, 19 August 2017 at 18:33:37 UTC, WhatMeWorry wrote:
Or maybe another approach would be to ask, what type is the
compiler replacing auto with.
If you want to find out compile with `-vcg-ast`
On Saturday, 19 August 2017 at 10:16:18 UTC, Balagopal Komarath
wrote:
Let us say I want to automatically define subtraction given
that addition and negation are defined. I tried the following
using mixin templates. If I simply mixin the template using
"mixin sub;", then it gives the error
[.
On Wednesday, 23 August 2017 at 09:53:49 UTC, biocyberman wrote:
I lost my momentum to learn D and want to gain it up again.
Therefore I need some help with this seemingly simple task:
# Fasta sequence
\>Entry1_ID header field1|header field2|...
CAGATATCTTTGATGTCCTGATTGGAAGGACCGTTGGCCACC
I want to wrap:
ErrorEnum function(Struct* s, void function(Struct*, ErrorEnum
status, void *userData) callback, void *userData, uint flags);
as a member of a wrapping struct
struct Mystruct
{
Struct* s; // wrapped
ErrorEnum addCallback(void delegate(Struct*, ErrorEnum
status))
On Friday, 25 August 2017 at 13:49:20 UTC, Kagamin wrote:
You're not specific enough. What would be semantics of such
wrapper?
The C function I'm trying to wrap takes a function pointer which
is essentially a delegate, but not quite:
ErrorEnum function(Struct* s, void function(Struct*, Error
On Saturday, 26 August 2017 at 00:27:47 UTC, Ali Çehreli wrote:
I think you need a variation of intermediateCallback() below. I
passed the address of the delegate as userData but you can
construct any context that contains everything that you need
(e.g. the address of ms).
import std.stdio;
My project is a library, but I also need to test it and unit
tests won't cut it (external hardware).
How do you set up the dub.json to build the library normally but
when it is invoked with `dub test` it runs a separate
configuration that also includes files in the `source/test`
folder, but a
On Thursday, 31 August 2017 at 07:04:13 UTC, Jacob Carlborg wrote:
On 2017-08-31 08:41, Nicholas Wilson wrote:
My project is a library, but I also need to test it and unit
tests won't cut it (external hardware).
How do you set up the dub.json to build the library normally
but when it is invok
On Friday, 1 September 2017 at 09:38:59 UTC, Alex wrote:
Hi all!
Say, I have
struct A(T...)
{
T arr;
}
struct B(T...)
{
T[] arr;
}
void main()
{
A!(int[], double[]) a;
a.arr[0] ~= 5;
a.arr[0] ~= 6;
static assert(!__traits(compiles, a.arr[0] ~= 3.
So I have the following types
struct DevicePointer(T) { T* ptr; }
struct Buffer(T)
{
void* driverObject;
T[] hostMemory;
}
and a function
auto enqueue(alias k)(HostArgsOf!k) { ... }
where k would be a function like
void foo( DevicePointer!float a, float b , int c) { ... }
How can I
On Friday, 1 September 2017 at 10:58:51 UTC, user1234 wrote:
On Friday, 1 September 2017 at 10:15:09 UTC, Nicholas Wilson
wrote:
So I have the following types
...
i.e. it substitutes the template DevicePointer for the
template Buffer in Parameters!foo,
The templates can be assumed to not be nes
On Friday, 1 September 2017 at 11:33:15 UTC, Biotronic wrote:
On Friday, 1 September 2017 at 10:15:09 UTC, Nicholas Wilson
wrote:
So I have the following types
struct DevicePointer(T) { T* ptr; }
struct Buffer(T)
{
void* driverObject;
T[] hostMemory;
}
and a function
auto enqueue(ali
On Friday, 1 September 2017 at 22:10:43 UTC, Biotronic wrote:
On Friday, 1 September 2017 at 19:39:14 UTC, EntangledQuanta
wrote:
Is there a way to create a 24-bit int? One that for all
practical purposes acts as such? This is for 24-bit stuff like
audio. It would respect endianness, allow for
On Friday, 1 September 2017 at 11:33:15 UTC, Biotronic wrote:
On Friday, 1 September 2017 at 10:15:09 UTC, Nicholas Wilson
wrote:
So I have the following types
struct DevicePointer(T) { T* ptr; }
struct Buffer(T)
{
void* driverObject;
T[] hostMemory;
}
and a function
auto enqueue(ali
On Saturday, 2 September 2017 at 10:15:04 UTC, Vino.B wrote:
Hi All,
Can you please guide me how can i use array appender for the
below piece of code
string[][] cleanFiles (string FFs, string Step) {
auto dFiles = dirEntries(FFs, SpanMode.shallow).filter!(a =>
a.isFile).map!(a => tuple(a.na
On Saturday, 2 September 2017 at 21:11:17 UTC, Vino.B wrote:
On Saturday, 2 September 2017 at 15:47:31 UTC, Vino.B wrote:
On Saturday, 2 September 2017 at 12:54:48 UTC, Nicholas Wilson
wrote:
[...]
Hi,
[...]
Hi,
Was able to resolve the above issue, but again getting the
same for other
On Monday, 4 September 2017 at 05:45:18 UTC, Vino.B wrote:
On Saturday, 2 September 2017 at 20:54:03 UTC, Vino.B wrote:
On Saturday, 2 September 2017 at 20:10:58 UTC, Moritz Maxeiner
wrote:
On Saturday, 2 September 2017 at 18:59:30 UTC, Vino.B wrote:
[...]
Cannot reproduce under Linux with d
On Monday, 4 September 2017 at 20:39:11 UTC, Igor wrote:
I found that I can't use __simd function from core.simd under
LDC
Correct LDC does not support the core.simd interface.
and that it has ldc.simd but I couldn't find how to implement
equivalent to this with it:
ubyte16* masks = ...;
fo
On Tuesday, 12 September 2017 at 01:13:29 UTC, Hasen Judy wrote:
Is this is a common beginner issue? I remember using an earlier
version of D some long time ago and I don't remember seeing
this concept.
Now, a lot of library functions seem to expect ranges as inputs
and return ranges as outpu
On Tuesday, 12 September 2017 at 03:51:45 UTC, Laeeth Isharc
wrote:
Hi.
I'm here in HK with Ilya, Atila, John Colvin, and Jonathan
Davis.
I wondered what the current state of D catching C++ exceptions
was on Linux and Windows. I know that some work was done on
making this possible, and my u
On Saturday, 16 September 2017 at 21:45:34 UTC, Nordlöw wrote:
How do I temporarily enable -vgc when building my app with DUB?
I've tried
DFLAGS=-vgc /usr/bin/dub build --build=unittest
but it doesn't seem to have any effect as it doesn't rebuild
directly after the call
/usr/bin/dub build -
On Sunday, 17 September 2017 at 11:42:16 UTC, kerdemdemir wrote:
Hi,
Thanks its price dropped to 10 Euros I bought the the D Web
Development book and I were trying to build some examples.
The example in Chapter3 called noteapp4 is giving me this error
:
[...]
Optlink bug I guess?
try usin
On Tuesday, 19 September 2017 at 11:47:00 UTC, Timothy Foster
wrote:
I'm trying to compile my project as a Win64 application but
this is happening:
Building C:\Users\me\test\test.exe...
OPTLINK (R) for Win32 Release 8.00.17
Copyright (C) Digital Mars 1989-2013 All rights reserved.
http://www.
On Friday, 22 September 2017 at 04:37:44 UTC, Enjoys Math wrote:
On Friday, 22 September 2017 at 04:25:00 UTC, Enjoys Math wrote:
I've tried opening the port for TCP with windows 10 firewall
settings. Same result.
What tool would best help me debug this? Wireshark or is that
too low level?
I want to use a fork of one of my dub dependencies so I can make
sure that it works before I merge the fork into upstream.
http://code.dlang.org/advanced_usage
says
Path-based dependencies
Package descriptions in the dub.json/dub.sdl can specify a
path instead of a version; this can be
On Saturday, 23 September 2017 at 04:45:47 UTC, Mike Parker wrote:
On Saturday, 23 September 2017 at 03:13:15 UTC, Nicholas Wilson
wrote:
my dub.selections.json is currently:
{
"fileVersion": 1,
"versions": {
"derelict-cl": "2.0.0",
"derelict-cu
On Saturday, 23 September 2017 at 09:37:54 UTC, rikki cattermole
wrote:
On 23/09/2017 10:34 AM, Guillaume Piolat wrote:
On Saturday, 23 September 2017 at 03:16:30 UTC, rikki
cattermole wrote:
Alternatively you can alter the package that dub already
knows about.
Does the trick more easily ;)
On Saturday, 23 September 2017 at 08:45:00 UTC, Mengu wrote:
hello everyone
i have a small program that parses an xml file, holding a list
with 13610 elements. after making the list, it iterates over
the list (paralele), goes to a web site and grabs the related
data for that element.
it wor
On Saturday, 23 September 2017 at 11:23:26 UTC, Nicholas Wilson
wrote:
Only other thing I can suggest is try linking against a debug
phobos to see if you can get some more diagnostics.
You might also try LDC's -fsanitize=address option for catching
memory bugs.
On Saturday, 23 September 2017 at 11:58:40 UTC, Mengu wrote:
hi all
i've successfully compiled phobos master with gmake on freebsd.
(make fails, i've no clue at all as to why)
how do i compile my project now against my local phobos with
dub? with plain dmd?
i tried (in dub.sdl):
- full pat
On Wednesday, 27 September 2017 at 09:00:55 UTC, Ky-Anh Huynh
wrote:
Hi,
Can I have a `break` option when using `dirEntries()` (similar
to `break` in a loop)? I want to study sub-directories but if
any sub-directory matches my criteria I don't to look further
into their subdirectories
```
On Wednesday, 27 September 2017 at 11:59:16 UTC, Arav Ka wrote:
GCC supports a `__attribute((section("...")))` for variables to
put them in specific sections in the final assembly. Is there
any way this can be achieved in D? Does GDC support this?
GDC should
https://github.com/D-Programming-GD
101 - 200 of 612 matches
Mail list logo
