Hi,
I'm trying to use std.typecons.RefCounted on recursive structures
to emulate garbage-collected classes, but it doesn't work,
because the RefCounted implementation ends up creating a cycle in
the structure hierarchy.
import std.typecons: RefCounted;
struct S
{
RefCounted!S s; // erro
On Tuesday, 10 May 2016 at 22:10:06 UTC, ag0aep6g wrote:
Am 10.05.2016 um 21:43 schrieb Lodovico Giaretta:
import std.typecons: RefCounted;
struct S
{
RefCounted!S s; // error: struct S no size yet for
forward reference
}
This used to work with 2.067. I've filed a phobos regression
fo
Hi,
Today I stumbled upon this weird error:
struct ConfigContainer
{
Config[string] configs;
}
struct Config
{
string foo;
string bar;
}
enum ConfigContainer cc = {
configs: [// error: not an associative array
initializer
On Tuesday, 24 May 2016 at 06:59:18 UTC, Jacob Carlborg wrote:
What we need is something like this [1]:
auto c = Config{ foo: "foo", bar: "bar };
The compiler will know for sure that "c" is of type Config
because the right side includes the type.
[1] https://issues.dlang.org/show_bug.cgi?id=
Let's say I have a generic function that uses pointers. It will
be inferred @system by the compiler, but I know that the pointer
usage can be @trusted.
The problem is that if I declare the function @trusted, I'm also
implicitly trusting any call to @system methods of the template
parameter.
D
On Saturday, 28 May 2016 at 11:57:09 UTC, Era Scarecrow wrote:
Use traits..
https://dlang.org/phobos/std_traits.html#isSafe
so your function becomes (i believe)
auto doSomethingDumb(T)(ref T t) if(isSafe!(T))
The problem is that T is a type, and I should check for safety of
every meth
On Saturday, 28 May 2016 at 12:33:28 UTC, Era Scarecrow wrote:
On Saturday, 28 May 2016 at 12:25:14 UTC, Lodovico Giaretta
wrote:
On Saturday, 28 May 2016 at 11:57:09 UTC, Era Scarecrow wrote:
auto doSomethingDumb(T)(ref T t) if(isSafe!(T))
The problem is that T is a type, and I should ch
On Saturday, 28 May 2016 at 12:45:21 UTC, Era Scarecrow wrote:
On Saturday, 28 May 2016 at 12:25:14 UTC, Lodovico Giaretta
wrote:
The problem is that T is a type, and I should check for safety
of every method of T that I'm using in my function. This does
not scale well, and if I change the body
On Saturday, 28 May 2016 at 12:45:21 UTC, Era Scarecrow wrote:
Fourth, you could create a helper function/template that
cycles through a struct of your choice and tells you if any of
it's methods fail to be safe. This will require a little more
work, but it could be used as a full insurance an
On Saturday, 28 May 2016 at 13:03:10 UTC, Adam D. Ruppe wrote:
What kind of pointer usage do you have? Remember that basic &
and * operations ARE @safe.
If you have more internally, you might be able to wrap them up
in an @trusted function to again allow inference to work.
Ouch! I was under
On Saturday, 28 May 2016 at 14:01:35 UTC, Era Scarecrow wrote:
On Saturday, 28 May 2016 at 13:10:56 UTC, Lodovico Giaretta
wrote:
The only problem is that these structures are parameterized,
and the type parameters may have unsafe operations that I use.
Do you still want the template i'm buil
On Sunday, 29 May 2016 at 18:02:53 UTC, Steven Schveighoffer
wrote:
You can create a trusted expression by using a lambda and
immediately calling it. ag0aep6g brought it up.
I would write it like this (untested, but I think this works):
return (()@trusted => &t)().doSomething();
The key is to
On Friday, 17 June 2016 at 10:50:55 UTC, Gary Willoughby wrote:
I have a struct where I need to perform default initialization
of some members but the compiler doesn't allow to define a
default constructor which allow optional arguments.
struct Foo(T)
{
private int _bar;
this(int bar
Hi,
I'm trying to achieve perfect forwarding of any invocation from
the wrapper to the wrapped item, but I'm having a bad time with
@property.
Suppose this is my wrapper (with all logic stripped):
struct Wrapper(T)
{
private T wrapped;
template hasAssignableProperty(
On Tuesday, 21 June 2016 at 21:11:39 UTC, ag0aep6g wrote:
Works when you change the return type of the the @property
opDispatch to auto, so that it can return the result. It's a
little weird, but D does support calling functions with
assignment syntax.
Alternatively, maybe you can actually ch
On Saturday, 25 June 2016 at 08:46:05 UTC, John wrote:
Writing a long series of "static if ... else" statements can be
tedious and I'm prone to leaving out the crucial "static" after
"else", so I was wondered if it was possible to write a
template that would resemble the switch statement, but f
On Saturday, 25 June 2016 at 09:07:19 UTC, Lodovico Giaretta
wrote:
Instead of passing functions to match!, pass pairs of
arguments, like this:
match!(T,
int, writeln("Matched int"),
is(T : SomeObject), writeln("Derives from SomeObject");
);
Now, in the implementation
On Saturday, 25 June 2016 at 10:39:09 UTC, John wrote:
Thanks for the help, both. This appeared to work, until I
realised the lambda isn't static:
void match(T, cases...)() {
static if (cases.length == 1) cases[0]();
else static if (cases.length > 2) {
static if (is(typeof(cases
On Saturday, 25 June 2016 at 12:30:22 UTC, Lodovico Giaretta
wrote:
If you want this to work, you need your lambdas to take the
casted value as a parameter:
void test(T)(T value) {
int i;
string s;
match!(value,
int, (val) => i = val,
string, (val) => s = val
On Monday, 27 June 2016 at 16:40:09 UTC, Nordlöw wrote:
If I have a template parameter
E = S!int
where
struct S(T) { S x; }
how can I extract the template name part `S` from E`?
Something like:
static assert(is(templateName!(S!int) == S));
Is this already in Phobos somewhere?
On Wednesday, 29 June 2016 at 17:00:49 UTC, Guido wrote:
I have all this business generally working in C++. I just
wanted to try D for a production level quick project. So, the
language is not ready. I'm really sad about this. I had hoped
that I could get some useful work done. C++ is painfully
On Saturday, 2 July 2016 at 12:10:28 UTC, qznc wrote:
I want to implement some caching for HTTP GET requests.
Basically a map of URL to content. A cache needs some
additional meta data (size, age, etc).
There seem to be two basic data structures available:
Associative array (AA) or red black
On Sunday, 3 July 2016 at 16:03:51 UTC, qznc wrote:
On Saturday, 2 July 2016 at 12:21:14 UTC, Lodovico Giaretta
wrote:
On Saturday, 2 July 2016 at 12:10:28 UTC, qznc wrote:
Alternatively, any better idea to implement the cache? I
guess there is no off-the-shelf/dub solution.
For now, I settle
On Friday, 1 July 2016 at 12:02:11 UTC, tcak wrote:
I have my own Http Server. Every request is handled by a
thread, and threads are reused.
I send 35,000 request (7 different terminals are sending 5000
requests each) to the server again and again (each of them
lives for short).
Anyway, eve
On Sunday, 3 July 2016 at 18:25:32 UTC, tcak wrote:
Well, I actually have found out about the issue, and solved it
a different way.
I put memory limit on the process for testing.
At some point, due to memory limitation, thread.start() method
fails. But, this method cannot recover the system c
On Wednesday, 6 July 2016 at 09:08:11 UTC, zodd wrote:
So, I've created a simple wrapper template to achieve what I
want. It reminds me of the C++ - a bunch of additional code to
solve a simple problem (which shouldn't be an issue at all).
I'm a newbie in D thus I could do something wrong or
n
On Wednesday, 6 July 2016 at 21:44:37 UTC, BitGuy wrote:
I'm trying to implement a feistel cipher that'll give the same
results regardless of the endianness of the machine it runs on.
To make the cipher I need to split a 64bit value into two 32bit
values, mess with them, and then put them back
On Thursday, 7 July 2016 at 08:14:40 UTC, Gary Willoughby wrote:
What about something like:
import std.stdio;
union Value
{
ulong full;
static struct Bits
{
uint high;
uint low;
}
Bits bits;
alias bits this;
this(ulong value)
{
this.fu
On Thursday, 7 July 2016 at 09:33:38 UTC, Arafel wrote:
Hi!
I am seeing what it seems to me a very strange behavior with
rbtrees:
---
import std.stdio;
import std.container.rbtree;
public struct A {
public int i;
public this (int _i) {
this.i = _i;
On Thursday, 7 July 2016 at 09:40:57 UTC, Lodovico Giaretta wrote:
Initially it looks very surprising, but then if you add
`writeln(B.init.col[]);` you can easily find out what's going
on.
And I'm quite sure it's expected behaviour.
An RBTree is just a pointer to the memory containing the ac
On Thursday, 7 July 2016 at 10:45:12 UTC, Gary Willoughby wrote:
On Thursday, 7 July 2016 at 08:21:53 UTC, Lodovico Giaretta
wrote:
Are you sure that this works in both big-endian and
little-endian systems?
It shouldn't matter. You're just interested in the high and low
4 byte chunks (which a
On Saturday, 9 July 2016 at 11:46:14 UTC, Tofu Ninja wrote:
On Saturday, 9 July 2016 at 11:35:24 UTC, Tofu Ninja wrote:
On Saturday, 9 July 2016 at 11:29:18 UTC, ketmar wrote:
On Saturday, 9 July 2016 at 11:24:01 UTC, Tofu Ninja wrote:
Seems pretty silly to me...
due to universally beloved a
On Sunday, 10 July 2016 at 19:50:28 UTC, Adam Sansier wrote:
On Sunday, 10 July 2016 at 19:44:01 UTC, Adam D. Ruppe wrote:
On Sunday, 10 July 2016 at 19:19:57 UTC, Adam Sansier wrote:
Is it possible to turn temporary char/wchar buffer in to a
string to be used by string functions rather than ha
On Monday, 11 July 2016 at 18:54:44 UTC, George M wrote:
Hello everybody,
sorry for my bad english(nativ german). D is a very nice
language and easy to learn because i am a c# (only private)
developer.
The only bad is to find examples is very hard.
My question:
How can i sort a slist or dlis
On Tuesday, 12 July 2016 at 11:26:20 UTC, jj75607 wrote:
I want to use aspect-like annotations to transform
@Lockable
class Abc
{
@sync
void f() {
writeln("f");
}
@shared
void g() {
writeln("g");
}
}
to something like:
class Ab
On Tuesday, 12 July 2016 at 13:44:02 UTC, Adam Sansier wrote:
On Tuesday, 12 July 2016 at 08:52:26 UTC, Kagamin wrote:
Extract functions for shared parts:
void Do(string name)
{
DoStuff();
int i = find(name);
DoStuffWithIndex(i);
}
void Do(int name)
{
DoStuff();
DoStuffWith
On Tuesday, 12 July 2016 at 15:09:26 UTC, Adam Sansier wrote:
So, com throughs me a interface ptr and I need to map it to an
interface. When I do, I get an access violation.
I have an (com) ptr and an interface. How do I link them up so
I can call the functions?
I marked the interface extern
On Tuesday, 12 July 2016 at 16:30:05 UTC, Adam Sansier wrote:
Doesn't matter, it's not what I asked. Trying to provide
answers to a question that wasn't asked and was clearly stated
I wasn't interested in those types of answers.
Every language has its own ways of solving various problems.
We a
On Tuesday, 12 July 2016 at 16:27:52 UTC, Adam Sansier wrote:
On Tuesday, 12 July 2016 at 13:54:16 UTC, Lodovico Giaretta
Also note that yield semantics as available in various
languages is much different from what you are proposing here.
Not really. Yield is usually a break in flow, regardles
On Tuesday, 12 July 2016 at 18:54:18 UTC, Charles Hixson wrote:
I want to open a file with an exclusive lock. It would be
important that no other thread be able to access the file in
write mode, and desirable that no other thread be able to
access the file in read mode. (Ditto for other proce
On Tuesday, 12 July 2016 at 21:21:04 UTC, Adam Sansier wrote:
On Tuesday, 12 July 2016 at 15:12:21 UTC, Lodovico Giaretta
wrote:
I'm not an expert in this field, but did you read this[1]?
[1] https://dlang.org/spec/interface.html#com-interfaces
Yes, of course...
Well, I asked because you s
On Wednesday, 13 July 2016 at 00:57:38 UTC, Adam Sansier wrote:
How about simply setting aside a 100kb of memory as a pool for
exceptions. Seems like a lot but still under 640kb, hell, even
1MB would still be tiny.
After all, it's not like exceptions are common or happen in
complex ways.
Do
On Wednesday, 13 July 2016 at 11:59:18 UTC, Miguel L wrote:
I am using a temporary dynamic array inside a loop this way:
A[] a;
for()
{
a=[]; //discard array contents
... appends thousand of elements to a
... use a for some calculations
}
I would like to know which would be the best way to c
On Wednesday, 13 July 2016 at 12:20:07 UTC, cym13 wrote:
The best option would be a.clear(). From the language specs:
“Removes all remaining keys and values from an associative
array. The array is not rehashed after removal, to allow for
the existing storage to be reused. This will affect all
On Wednesday, 13 July 2016 at 12:37:26 UTC, Miguel L wrote:
I tried Appender, but for some reason garbage collector still
seems to be running every few iterations.
I will try to expand a little on my code because maybe there is
something i am missing:
Appender!(A[]) a;
void foo( out Appende
On Wednesday, 13 July 2016 at 16:13:21 UTC, Adam Sansier wrote:
On Wednesday, 13 July 2016 at 11:39:11 UTC, Lodovico Giaretta
wrote:
On Wednesday, 13 July 2016 at 00:57:38 UTC, Adam Sansier wrote:
[...]
You shall use a static per-thread Region allocator[1] backed
by Mallocator[2].
Then you
On Wednesday, 13 July 2016 at 20:44:52 UTC, Adam Sansier wrote:
On Wednesday, 13 July 2016 at 16:28:23 UTC, Lodovico Giaretta
wrote:
It's actually quite easy. Here's the code (untested):
import std.experimental.allocator.buildin
On Wednesday, 13 July 2016 at 21:12:29 UTC, Adam Sansier wrote:
The advantages over a simple malloc are:
1) You can change between GC allocation, malloc, mmap and
other allocators by changing a single line, instead of
changing every throw;
Ok, I like!
2) you can use very fast allocators, base
On Wednesday, 13 July 2016 at 22:42:36 UTC, Adam Sansier wrote:
On Wednesday, 13 July 2016 at 21:27:16 UTC, Lodovico Giaretta
wrote:
At the end, all memory comes from one of these: GC heap,
malloc, mmap, sbrk. All other allocators build on top of these
(or on top of user supplied buffers, which
On Thursday, 14 July 2016 at 19:28:23 UTC, Andrey wrote:
On Thursday, 14 July 2016 at 19:27:14 UTC, Andrey wrote:
Hi guys!
Help a newbie please.
Playing with D and trying to understand some features.
Here is my try to carry out my code from C++ project to D
struct Sigmoid(T)
{
const T Funct
As per title, is it possible to iterate all visible symbols of
the current module and of all imported modules and packages? My
aim is to find everything in scope that has a specific UDA.
module foo;
import std.stdio, std.array, std.algorithm;
void bar(){}
struct S{}
void main()
{
// pri
On Monday, 18 July 2016 at 18:21:41 UTC, ketmar wrote:
short answer: no.
there is still no way to write a reliable enumerator like this:
too much things to hack around.
as for module symbols, it is easy: they has no type. literally:
`!is(typeof(...))`.
`is(typeof(...))` is a necessary safe
On Monday, 18 July 2016 at 21:12:38 UTC, Meta wrote:
On Monday, 18 July 2016 at 13:00:16 UTC, Lodovico Giaretta
wrote:
As per title, is it possible to iterate all visible symbols of
the current module and of all imported modules and packages?
My aim is to find everything in scope that has a spe
On Tuesday, 19 July 2016 at 09:42:40 UTC, celavek wrote:
On Tuesday, 19 July 2016 at 09:41:32 UTC, John wrote:
On Tuesday, 19 July 2016 at 09:34:11 UTC, celavek wrote:
Hi,
I am trying to count characters in a string like:
const string dna_chain =
"AGCCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGA
On Tuesday, 19 July 2016 at 12:23:11 UTC, celavek wrote:
On Tuesday, 19 July 2016 at 09:57:27 UTC, Lodovico Giaretta
wrote:
On Tuesday, 19 July 2016 at 09:42:40 UTC, celavek wrote:
Works for me:
size_t[char] counts;
const string dna_chain =
"AGCCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTA
On Tuesday, 19 July 2016 at 13:33:41 UTC, jmh530 wrote:
On Tuesday, 19 July 2016 at 07:23:52 UTC, John wrote:
auto bar(T...)(T x)
{
static if (T.length == 1 && isTuple!(T[0]))
return foo(x.expand);
else
return foo(x);
}
Hmm, this actually doesn't seem to be resolving my issue. I'
On Tuesday, 19 July 2016 at 15:36:42 UTC, Lodovico Giaretta wrote:
As you have to do `isTuple!(T[0])`, you also have to do
`x[0].expand`.
That's because T... works "as if" it was an array of types, and
x, being of type T, it works "as if" it was an array of values.
So you have to use an index i
On Tuesday, 19 July 2016 at 15:55:02 UTC, Rufus Smith wrote:
I have some functions that take other functions. I would like
the attributes to be able to "fall" through so I get overload
like behavior. I only care that I am passing a function, not if
it is shared, extern(C), pure, @nogc, etc.
v
On Tuesday, 19 July 2016 at 16:50:56 UTC, Rufus Smith wrote:
On Tuesday, 19 July 2016 at 16:09:38 UTC, Lodovico Giaretta
wrote:
On Tuesday, 19 July 2016 at 15:55:02 UTC, Rufus Smith wrote:
I have some functions that take other functions. I would like
the attributes to be able to "fall" through
On Tuesday, 19 July 2016 at 17:05:55 UTC, Rufus Smith wrote:
On Tuesday, 19 July 2016 at 16:59:48 UTC, Lodovico Giaretta
wrote:
On Tuesday, 19 July 2016 at 16:50:56 UTC, Rufus Smith wrote:
On Tuesday, 19 July 2016 at 16:09:38 UTC, Lodovico Giaretta
wrote:
[...]
But this doesn't create a func
On Wednesday, 20 July 2016 at 05:54:41 UTC, mogu wrote:
On Wednesday, 20 July 2016 at 01:50:37 UTC, Adam D. Ruppe wrote:
On Wednesday, 20 July 2016 at 01:14:05 UTC, mogu wrote:
Why S's type isn't something like `S: (T) -> S`?
Because S isn't a type... think of a template as being like a
func
On Wednesday, 20 July 2016 at 18:08:14 UTC, stunaep wrote:
On Wednesday, 20 July 2016 at 05:45:21 UTC, Jonathan M Davis
wrote:
On Wednesday, July 20, 2016 04:03:23 stunaep via
Digitalmars-d-learn wrote:
[...]
If you want the list of members in an enum, then use
std.traits.EnumMembers and you
On Thursday, 21 July 2016 at 09:41:27 UTC, Saurabh Das wrote:
I have an interface A which declares a certain function. A
second interface B inherits from A and wishes to provide a
default implementation for that function. How can I achieve
this? I'm facing an error when I try this:
interface
On Thursday, 21 July 2016 at 09:46:10 UTC, Lodovico Giaretta
wrote:
Interesting.
This is worth a bugzilla issue, IMHO. In fact, if you try the
other way (i.e.: you provide an implementation of func in class
C), you get the opposite error, that you are overriding a final
function (B.func).
Su
On Friday, 22 July 2016 at 18:30:13 UTC, Rufus Smith wrote:
Trying to compile code that uses GDC, had to import phobos
files from dmd in to project since they are not in the GDC's
phobo lib(the core.sys.windows stuff).
Almost all the errors are related to stuff like
PALETTEENTRY* peNew() retu
On Friday, 22 July 2016 at 18:30:13 UTC, Rufus Smith wrote:
Trying to compile code that uses GDC, had to import phobos
files from dmd in to project since they are not in the GDC's
phobo lib(the core.sys.windows stuff).
Almost all the errors are related to stuff like
PALETTEENTRY* peNew() retu
On Friday, 22 July 2016 at 20:26:50 UTC, Rufus Smith wrote:
On Friday, 22 July 2016 at 19:52:59 UTC, Lodovico Giaretta
wrote:
On Friday, 22 July 2016 at 18:30:13 UTC, Rufus Smith wrote:
Trying to compile code that uses GDC, had to import phobos
files from dmd in to project since they are not in
On Saturday, 23 July 2016 at 13:18:03 UTC, Rufus Smith wrote:
Trying to compare a *ptr value with a value in nogc code
results in the error:
Error: @nogc function '...' cannot call non-@nogc function
'object.opEquals'
Shouldn't object opEquals be marked?
If object.opEquals is marked @nog
On Saturday, 23 July 2016 at 14:53:49 UTC, Rufus Smith wrote:
Um, this isn't right. GC code can always call non-gc code.
If you mark opEquals nogc, it breaks nothing except
implementations of opEquals that use the GC. GC code can still
call it nogc opequals, it only enforces opEquals code to a
On Saturday, 23 July 2016 at 17:04:42 UTC, Jonathan Marler wrote:
On Saturday, 23 July 2016 at 16:46:20 UTC, Jonathan Marler
wrote:
[...]
Actually Im going to disagree with myself. This technique
actually wouldn't work with virtual methods:)
I don't think we have the big problems with @nogc
On Saturday, 23 July 2016 at 21:44:05 UTC, Rufus Smith wrote:
Templates are not the end all be all. They don't allow for
run-time polymorphism, which is an important aspect of software.
Ok, so you need runtime polymorphism. And you want it in @nogc
code. That's not difficult. Just have the bas
On Saturday, 23 July 2016 at 21:44:05 UTC, Rufus Smith wrote:
On Saturday, 23 July 2016 at 17:27:24 UTC, Lodovico Giaretta
wrote:
- we trust what we are doing: e.g. we cannot mark a thing
@nogc, but we know it is and the profiler confirms that no
allocation happens, so we are happy; our aim
On Sunday, 24 July 2016 at 02:17:27 UTC, Rufus Smith wrote:
This just isn't right. What your saying is that because someone
screwed up, we must live with the screw up and build everyone
around the screw up. This mentality is why everyone is so
screwed up in the first place, do you not see that?
On Sunday, 24 July 2016 at 14:54:11 UTC, Jonathan Marler wrote:
I believe Rufus was only referring to the virtual methods
defined in the object class. That would be:
toHash (Note: this is already nothrow, that's intersting and
quite restrictive)
opCmp
opEquals
I think all 3 of these are goo
On Sunday, 24 July 2016 at 15:28:53 UTC, Jonathan Marler wrote:
Whoa wait a second...I didn't know you could do this. I
thought everything had to inherit from the object class. Can
you share the syntax to define a class that doesn't derive from
object?
Currently, you cannot. Everything inhe
On Sunday, 24 July 2016 at 15:31:28 UTC, lqjglkqjsg wrote:
Almost off topic but I've recognized a typical error here, I
think that many of us have already seen it too. You develop a
nice class. You put attributes everywhere @safe pure nothrow
@nogc. Yay the unittest pass.
Later you use it for
On Thursday, 28 July 2016 at 09:10:33 UTC, Kagamin wrote:
Create an RFE? Given that regex returns results as slices of
the input string, using the replacement character doesn't
introduce data corruption.
(RFE = Request For Enhancement, right?)
Yes, all algorithms that use decode internally sha
On Thursday, 28 July 2016 at 14:33:26 UTC, Dechcaudron wrote:
On Thursday, 28 July 2016 at 14:01:45 UTC, Suliman wrote:
2. Should I call destructor and how it's should like?
You certainly want to close the connection to the db.
Basically, the destructor is intended to free resources such as
dy
On Thursday, 28 July 2016 at 15:02:58 UTC, Dechcaudron wrote:
On Thursday, 28 July 2016 at 14:43:32 UTC, Lodovico Giaretta
wrote:
No! Never run important finalization in a class destructor!
The GC is not obliged to run the destructors, so you may end
up with your objects destroyed but the conne
On Thursday, 28 July 2016 at 15:24:22 UTC, Dechcaudron wrote:
On Thursday, 28 July 2016 at 15:18:24 UTC, Lodovico Giaretta
wrote:
3) at program end, live objects are not scheduled for
finalization;
4) at program end, pending finalizations from previous
collections may not be run.
I didn't kno
On Friday, 29 July 2016 at 13:18:00 UTC, Suliman wrote:
Use the `destroy` function to finalize an object by calling its
destructor. The memory of the object is not immediately
deallocated, instead the GC will collect the memory of the
object at an undetermined point after finalization:
class
On Wednesday, 10 August 2016 at 15:20:37 UTC, Arafel wrote:
I'm not sure if the following is even expected to work, since
I'm not sure how the vtable for the interface would look like
(well, that would be applicable to any overriden templated
method, though):
---
public interface I {
On Wednesday, 10 August 2016 at 15:39:19 UTC, Arafel wrote:
On Wednesday, 10 August 2016 at 15:25:40 UTC, Lodovico Giaretta
wrote:
Because templated functions cannot be virtual, it follows that
I.func is final. Having no body, the compiler thinks that its
body will be found by the linker in ano
On Wednesday, 10 August 2016 at 15:48:10 UTC, Lodovico Giaretta
wrote:
On Wednesday, 10 August 2016 at 15:39:19 UTC, Arafel wrote:
Would it even make sense to "force" (deprecation warning) a
"final" keyword in any implicitly-final function (I wasn't
even aware of those, I have to admit)? It wou
On Wednesday, 10 August 2016 at 15:54:42 UTC, Adam D. Ruppe wrote:
On Wednesday, 10 August 2016 at 15:48:10 UTC, Lodovico Giaretta
wrote:
I read the spec again, and found out that it says interfaces
cannot contain templated functions... So either my
interpretation is the intended one and the sp
I'm probably missing something stupid but...
Why on earth do the two loops in main print a different result?
It looks like the foreach lowering is ignoring my definition of
front...
=
import std.stdio, std.container.array;
struct RangeWrapper
On Wednesday, 10 August 2016 at 18:08:02 UTC, Lodovico Giaretta
wrote:
I'm probably missing something stupid but...
Why on earth do the two loops in main print a different result?
It looks like the foreach lowering is ignoring my definition of
front...
=
On Wednesday, 10 August 2016 at 18:38:00 UTC, Ali Çehreli wrote:
RangeWrapper does not provide the InputRange interface, so the
compiler uses 'alias this' and iterates directly on the member
range.
I tried making RangeWrapper an InputRange but failed. It still
uses 'range'.
// Still fails w
On Wednesday, 10 August 2016 at 19:37:39 UTC, Ali Çehreli wrote:
A quick read reveals popFront() is implemented only for bool
Arrays. That explains the issue.
I don't know whether it's an oversight.
Ali
First of all, thank you for spending your time on this issue. I
really appreciate that.
On Wednesday, 10 August 2016 at 20:54:15 UTC, Steven
Schveighoffer wrote:
On 8/10/16 2:08 PM, Lodovico Giaretta wrote:
[...]
The issue is that it tries using [] on the item to see if it
defines a range-like thing. Since you don't define opSlice(),
it automatically goes to the subrange.
Thi
On Wednesday, 10 August 2016 at 21:00:01 UTC, Lodovico Giaretta
wrote:
On Wednesday, 10 August 2016 at 20:54:15 UTC, Steven
Schveighoffer wrote:
[...]
Wow. Thanks. I didn't know the compiler would try opSlice. I
will file it.
Filed on bugzilla:
https://issues.dlang.org/show_bug.cgi?id=1637
On Thursday, 11 August 2016 at 18:11:30 UTC, Engine Machine wrote:
[...]
If, in your case, it is possible to use one type as the other,
then specify it.
I mean, implement a templated opAssign that allows you to assign
values of one instantiation to values of another. While doing so,
remember
On Thursday, 11 August 2016 at 20:27:51 UTC, Michael Coulombe
wrote:
Is there a way to implement "getSymbolOfCall" and
"getDelegateOfCall" such that doit is functionally equivalent
to calling the method directly?
auto doit(C, string methodName, Args...)(C c, Args args) {
alias methodSymbol
On Monday, 15 August 2016 at 15:01:13 UTC, Oleg B wrote:
Hello.
In std.xml docs I read that is deprecated, [...]
For XML I found this project
https://github.com/lodo1995/experimental.xml. Is this really
candidate to std, or author just called it as he want?
Hi!
I'm the developer of that XML
On Tuesday, 16 August 2016 at 15:46:23 UTC, WhatMeWorry wrote:
I've got a large Visual Studio Solution which contains lots of
Projects. Each project is a standalone D/OpenGL tutorial. I
want to make it OS and IDE agnostic so it can be easily played
with on Windows, Linux, and Mac OS so I th
On Monday, 15 August 2016 at 19:31:14 UTC, Engine Machine wrote:
Suppose I have a templated type like
struct S(T) { int x; static if (T is Y) int y; }
I would like to be able to create a reference to S(T) for any T,
struct Q
{
S!* s; // Can hold any type of S.
}
and be able to access s.x, s
On Tuesday, 16 August 2016 at 19:23:51 UTC, Engine Machine wrote:
On Tuesday, 16 August 2016 at 17:39:14 UTC, Lodovico Giaretta
wrote:
On Monday, 15 August 2016 at 19:31:14 UTC, Engine Machine
wrote:
[...]
I don't know if this is exactly what you want:
=
i
On Tuesday, 16 August 2016 at 23:18:28 UTC, Adam D. Ruppe wrote:
On Tuesday, 16 August 2016 at 19:17:27 UTC, Engine Machine
wrote:
alias x = AliasSeq!(a, b, AliasSeq!(c, d));
results in a flat sequence. I would like to be able to keep
them separate so I can have sub sequences.
wrap them in a
On Wednesday, 17 August 2016 at 13:21:16 UTC, Cauterite wrote:
On Wednesday, 17 August 2016 at 13:18:06 UTC, Adam D. Ruppe
wrote:
Best you can do is use them in an alias argument directly, but
you cannot use them in an enum argument.
I think you missed the point; it works perfectly fine withou
On Wednesday, 17 August 2016 at 19:15:48 UTC, ag0aep6g wrote:
On 08/17/2016 08:38 PM, Engine Machine wrote:
On Wednesday, 17 August 2016 at 08:37:32 UTC, Lodovico
Giaretta wrote:
[...]
You mean something like:
struct MySequence(Args...)
{
enum length = Args.length;
alias args = Args;
1 - 100 of 145 matches
Mail list logo
