Re: [galaxy-user] Blast on Galaxy?

Thanks Björn for the information and the links :) I'm going to investigate galaxy and see if I can resolve the doubts. Cheers, Jorge Subject: Re: [galaxy-user] Blast on Galaxy? From: bjoern.gruen...@pharmazie.uni-freiburg.de To: braun_...@hotmail.com CC: galaxy-user@lists.bx.psu.edu

Re: [galaxy-user] FW: Tophat/Cuff parameters

Thanks a lot Jen! Irene From: Jennifer Jackson [j...@bx.psu.edu] Sent: Saturday, November 16, 2013 6:57 PM To: Irene Bassano Cc: galaxy-u...@bx.psu.edu Subject: Re: [galaxy-user] FW: Tophat/Cuff parameters Hi, Yes, the .py part of the wrapper you

[galaxy-user] Mean inner distance

Hi Vanessa, Mean inner distance can be thought of as being the estimated gap left between the two ends of the paired reads. This is from the manual (also at the bottom of the Tophat tool form): -r This is the expected (mean) inner distance between mate pairs. For, example, for paired end

[galaxy-user] help for trim sequences

Hi, I am a galazy user and I want to trim exact sequences (not the location) from 5' end. Is there any tool I can use for this? For example, *AATGATACGGCGAC­CACCG **AACACTGCGTTTGCTGGCTTTG*ATG From this sequence, I want to remove *AATGATACGGCGAC­CACCG,* *so I can get

[galaxy-user] compute an expression on every row question

Hello, I am looking for the right way to do a computation using text manipulation, compute an expression on every row. I have a table consisting of 20 columns and about 15.000 rows. Column 1 is my untreated or control and I would like to normalize every other column to this control by simple