Re: [galaxy-user] copy number variation detcetion in Glaxay
Hello, The tool FreeBayes may be of interest. Please see the tool form for links to the primary tool documentation to see if the functionality will meet your needs. Best, Jen Galaxy team On 8/15/12 4:46 AM, shamsher jagat wrote: Is there any tool/ combination of tools with in galaxy which can detect CNV. I have 100X paired sequencing data between cancer and normal. Thanks ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ -- Jennifer Jackson http://galaxyproject.org ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
[galaxy-user] Cuffdiff errors
Hello, I am having a problem running Cuffdiff on some RNA-seq data. I want to compare 2 samples (A and B). I did Cufflinks and Cuffmerge before running Cuffdiff. I ran Cuffdiff with the following options: Cuffmerge + Bowtie A, B (sorted required by Cufflinks after mapped with Bowtie). But I got the following error message: An error occurred running this job: cuffdiff v1.3.0 (3022) cuffdiff --no-update-check -q -p 8 -c 10 --FDR 0.05 /galaxy/main_pool/pool4/files/004/800/dataset_4800173.dat /galaxy/main_pool/pool3/files/004/799/dataset_4799827.dat /galaxy/main_pool/pool4/files/004/799/dataset_4799831.dat Where did I do wrong? Thanks very much for your help! Yan ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] copy number variation detcetion in Glaxay
Thanks Jen, I am also intrested in this. Has any one used FreeBayes in Galaxy or out side Gaaxy to detect CNV from a ilumina sequencing data. Is their a tutorial for running this tools. Thanks. From: Jennifer Jackson j...@bx.psu.edu To: shamsher jagat kanwar...@gmail.com Cc: galaxy-user@lists.bx.psu.edu Sent: Thursday, August 16, 2012 12:48 AM Subject: Re: [galaxy-user] copy number variation detcetion in Glaxay Hello, The tool FreeBayes may be of interest. Please see the tool form for links to the primary tool documentation to see if the functionality will meet your needs. Best, Jen Galaxy team On 8/15/12 4:46 AM, shamsher jagat wrote: Is there any tool/ combination of tools with in galaxy which can detect CNV. I have 100X paired sequencing data between cancer and normal. Thanks ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ -- Jennifer Jackson http://galaxyproject.org ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Cuffdiff errors
Hi Yan, Would you please submit this as a bug report? It helps if you leave all inputs undeleted in your history. Instructions: http://wiki.g2.bx.psu.edu/Support#Reporting_tool_errors Thanks! Jen Galaxy team On 8/16/12 6:18 AM, Yan He wrote: Hello, I am having a problem running Cuffdiff on some RNA-seq data. I want to compare 2 samples (A and B). I did Cufflinks and Cuffmerge before running Cuffdiff. I ran Cuffdiff with the following options: Cuffmerge + Bowtie A, B (sorted required by Cufflinks after mapped with Bowtie). But I got the following error message: *An error occurred running this job: /cuffdiff v1.3.0 (3022) cuffdiff --no-update-check -q -p 8 -c 10 --FDR 0.05 /galaxy/main_pool/pool4/files/004/800/dataset_4800173.dat /galaxy/main_pool/pool3/files/004/799/dataset_4799827.dat /galaxy/main_pool/pool4/files/004/799/dataset_4799831.dat/* *//* Where did I do wrong? Thanks very much for your help! Yan ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ -- Jennifer Jackson http://galaxyproject.org ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Do I need to allow indel search?
Hello Jianguang, In simple terms, No produces a strict alignment and Yes produces a more permissive alignment. The option 'Allow indel search:' is a way of allowing for variability in your data (presumably biologically valid) to not be interpreted as mismatches or gaps. Mismatches/gaps in an alignment lower the overall score and can lead to alignment failures. The default for this parameter is Yes with value of 3 for insert/deletion length in Galaxy (allowing for simple nucleotide polymorphism variability up to a single codon, per position, in either the query or target). All values can be modified. If this interferes with your data mapping accurately, then it could be disabled by setting the parameter to No. A test comparing the two alternatives on a sample would be a good way to see how this single change affects your particular sample. Good questions to ask: What reads do not map when the stricter alignment rules are applied? Do any reads map with a change in specificity? Do you agree with the results? Hopefully this helps! Jen Galaxy team On 8/15/12 1:21 PM, Du, Jianguang wrote: Dear All, I want to compare the pre-mRNA alternaive splicing events between RNA-seq datasets. Do I need to allow indel search when I run Tophat? What is the indel search for? I could not find detail information about indel search through the documentation of Tophat. Thanks. Jianguang Du ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ -- Jennifer Jackson http://galaxyproject.org ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Use Own Junctions or not
Hello Jianguang, Junctions refer to known splice sites. TopHat has several options that work together to supply known junctions and to use them in various ways. This is used to direct splice identification. Given what you have explained about your experiment, I would not think this would be a desirable affect, so they are probably best left at default. Or, you could test to see the outcome. The parameter summary at the bottom of the tool form explains each and the manual can guide how to combine. To do more research on this, the tophat.cuffli...@gmail.com mailing list is the definitive source, but there are plenty of prior discussion threads at seqanswer.com and other places. Try a search with tophat junctions or add in some of the parameter names to help filter through the results. Best, Jen Galaxy team On 8/15/12 1:24 PM, Du, Jianguang wrote: Dear All, I want to compare the pre-mRNA alternaive splicing events between RNA-seq datasets. Should I use own junctions when I run Tophat? What does Own Junctions mean? Thanks. Jianguang DU ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ -- Jennifer Jackson http://galaxyproject.org ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] galaxy-user Digest, Vol 74, Issue 15
and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ -- Jennifer Jackson http://galaxyproject.org -- Message: 7 Date: Wed, 15 Aug 2012 20:21:21 + From: Du, Jianguang jia...@iupui.edu To: galaxy-user@lists.bx.psu.edu galaxy-user@lists.bx.psu.edu Subject: [galaxy-user] Do I need to allow indel search? Message-ID: 2b3c356fd95d6a41b0ccff77102e5edf12867...@iu-mssg-mbx106.ads.iu.edu Content-Type: text/plain; charset=iso-8859-1 Dear All, I want to compare the pre-mRNA alternaive splicing events between RNA-seq datasets. Do I need to allow indel search when I run Tophat? What is the indel search for? I could not find detail information about indel search through the documentation of Tophat. Thanks. Jianguang Du -- next part -- An HTML attachment was scrubbed... URL: http://lists.bx.psu.edu/pipermail/galaxy-user/attachments/20120815/ed2d0eda/attachment-0001.html -- Message: 8 Date: Wed, 15 Aug 2012 20:24:40 + From: Du, Jianguang jia...@iupui.edu To: galaxy-user@lists.bx.psu.edu galaxy-user@lists.bx.psu.edu Subject: [galaxy-user] Use Own Junctions or not Message-ID: 2b3c356fd95d6a41b0ccff77102e5edf12867...@iu-mssg-mbx106.ads.iu.edu Content-Type: text/plain; charset=iso-8859-1 Dear All, I want to compare the pre-mRNA alternaive splicing events between RNA-seq datasets. Should I use own junctions when I run Tophat? What does Own Junctions mean? Thanks. Jianguang DU -- next part -- An HTML attachment was scrubbed... URL: http://lists.bx.psu.edu/pipermail/galaxy-user/attachments/20120815/7ca0dc9f/attachment-0001.html -- Message: 9 Date: Thu, 16 Aug 2012 00:48:28 -0700 From: Jennifer Jackson j...@bx.psu.edu To: shamsher jagat kanwar...@gmail.com Cc: galaxy-user@lists.bx.psu.edu Subject: Re: [galaxy-user] copy number variation detcetion in Glaxay Message-ID: 502ca5cc.8020...@bx.psu.edu Content-Type: text/plain; charset=ISO-8859-1; format=flowed Hello, The tool FreeBayes may be of interest. Please see the tool form for links to the primary tool documentation to see if the functionality will meet your needs. Best, Jen Galaxy team On 8/15/12 4:46 AM, shamsher jagat wrote: Is there any tool/ combination of tools with in galaxy which can detect CNV. I have 100X paired sequencing data between cancer and normal. Thanks ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ -- Jennifer Jackson http://galaxyproject.org -- Message: 10 Date: Thu, 16 Aug 2012 21:18:01 +0800 From: Yan He yanh...@hotmail.com To: galaxy-user@lists.bx.psu.edu Subject: [galaxy-user] Cuffdiff errors Message-ID: blu0-smtp34493ac6e595ea755c7e677bf...@phx.gbl Content-Type: text/plain; charset=us-ascii Hello, I am having a problem running Cuffdiff on some RNA-seq data. I want to compare 2 samples (A and B). I did Cufflinks and Cuffmerge before running Cuffdiff. I ran Cuffdiff with the following options: Cuffmerge + Bowtie A, B (sorted required by Cufflinks after mapped with Bowtie). But I got the following error message: An error occurred running this job: cuffdiff v1.3.0 (3022) cuffdiff --no-update-check -q -p 8 -c 10 --FDR 0.05 /galaxy/main_pool/pool4/files/004/800/dataset_4800173.dat /galaxy/main_pool/pool3/files/004/799/dataset_4799827.dat /galaxy/main_pool/pool4/files/004/799/dataset_4799831.dat Where did I do wrong? Thanks very much for your help! Yan -- next part -- An HTML attachment was scrubbed... URL: http://lists.bx.psu.edu/pipermail/galaxy-user/attachments/20120816/f08c20fb/attachment-0001.html -- Message: 11 Date: Thu, 16 Aug 2012 08:09:15 -0700 From: Jennifer Jackson j...@bx.psu.edu To: Yan He yanh...@hotmail.com Cc: galaxy-user@lists.bx.psu.edu, closetic...@galaxyproject.org closetic...@galaxyproject.org Subject: Re: [galaxy-user] Cuffdiff errors Message-ID: 502d0d1b.60...@bx.psu.edu Content-Type: text/plain; charset=ISO-8859-1; format=flowed Hi Yan, Would you please submit this as a bug report? It helps if you leave all inputs undeleted in your history. Instructions: http://wiki.g2.bx.psu.edu/Support#Reporting_tool_errors Thanks! Jen Galaxy team On 8/16/12 6:18 AM, Yan
[galaxy-user] Counting intervals in one file overlapping intervals in another file - what are the hidden settings?
Hi, I am using the Count intervals in one file overlapping intervals in another file tool (part of the bedTools package) to assess the number of RNA-seq reads that map back to a specific region. (I am using this on the Galaxy test server). I am finding that this tool returns many more reads than it should. In reading the bedTools manual, it seems like this tool is the windowBed tool and it actually has many more parameters that are not shown on the Galaxy interface. What are these (hidden) settings for these parameters that are not shown? Hopefully this can explain my incorrectly recorded reads. Thanks in advance. Cheers, Mo Heydarian ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
[galaxy-user] Minimum length of read segments
Dear All, I am going to run Tophat with RNA-seq dataset to observe alternative splicing events. There is a parameter for Tophat: Minimum length of read segment. According to implemented Tophat options, the description for Minimum length of read segment is Each read is cut up into segments, each at least this long. These segments are mapped independently. The default is 25. The length of my reads is 36bps, should I change this parameter based on the length of my reads? How long should I input? Thanks. Jianguang Du ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
[galaxy-user] run Bowtie to estimate Mean Inner Distance between Mate Pairs
Dear All, In order to figure out the Mean Inner Distance between Mate Pairs of my paired-end RNA-seq datasets, I ran Bowtie (Map with Bowtie for Illumina) with both forward and reverse datasets and mouse mm9 as reference genome. Below I list the Bowtie output for only one pair of reads (I put the fields on the left side): For the forward read QNAME: SRR322837.8.1 FLAG:99 RNAME: chr1 POS: 163761156 MAPQ:255 CIAGR: 36M MRNM:= MPOS:163761301 ISIZE: 181 SEQ: NTGGATACTAGCCATAAATGAATT QUAL:%(,,')(())@@@22358852@@@## OPT: XA:i:1 MD:Z:0A35 NM:i:1 For the reverse read QNAME: SRR322837.8.2 FLAG:147 RNAME: chr1 POS: 163761301 MAPQ:255 CIAGR: 36M MRNM:= MPOS:163761156 ISIZE: -181 SEQ: TATTATGTCAATCTATGAAGAAGGACGGCGAGGTGA QUAL:GDBE@BEEGDB=BD-=GEDDGGBGD8GB? OPT: MD:Z:29A6 NM:i:1 Is the ISIZE the insert size? The difference between POS and MPOS is 145bp, which is 36bp shorter than ISIZE (181). My question is: if ISIZE does mean insert size, how should I convert INSIZE into Mean Inner Distance between Mate Pairs? Thanks, Jianguang Du ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] copy number variation detcetion in Glaxay
Hi Mathew, To clarify, freebayes is not designed to detect CNVs. It can CNV information detected in another method to correctly genotype at sites with copy number variations. If you have exome data, there is conifer http://http://conifer.sourceforge.net/ conifer.sourceforge.net/ http://conifer.sourceforge.net/. For more general applications, there is ERDS, http://www.duke.edu/~mz34/erds.htm I don't know if either of these will suit your needs. I use the CNV input methods in freebayes regularly for known, large variations in copy number, such as are seen on mammalian sex chromosomes. Best, Erik On Aug 16, 2012 11:11 AM, Mathew Bunj mathewb...@yahoo.com wrote: Thanks Jen, I am also intrested in this. Has any one used FreeBayes in Galaxy or out side Gaaxy to detect CNV from a ilumina sequencing data. Is their a tutorial for running this tools. Thanks. *From:* Jennifer Jackson j...@bx.psu.edu *To:* shamsher jagat kanwar...@gmail.com *Cc:* galaxy-user@lists.bx.psu.edu *Sent:* Thursday, August 16, 2012 12:48 AM *Subject:* Re: [galaxy-user] copy number variation detcetion in Glaxay Hello, The tool FreeBayes may be of interest. Please see the tool form for links to the primary tool documentation to see if the functionality will meet your needs. Best, Jen Galaxy team On 8/15/12 4:46 AM, shamsher jagat wrote: Is there any tool/ combination of tools with in galaxy which can detect CNV. I have 100X paired sequencing data between cancer and normal. Thanks ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ -- Jennifer Jackson http://galaxyproject.org ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
