Re: [galaxy-user] Blast on Galaxy?
Thanks Björn for the information and the links :) I'm going to investigate galaxy and see if I can resolve the doubts. Cheers, Jorge Subject: Re: [galaxy-user] Blast on Galaxy? From: bjoern.gruen...@pharmazie.uni-freiburg.de To: braun_...@hotmail.com CC: galaxy-user@lists.bx.psu.edu Date: Sun, 17 Nov 2013 21:16:55 +0100 Hi Jorge, My name is J.Braun and I am a new user of galaxy... It is a great tool for biologists. I have some questions and I would appreciate you could help me. 1) can I make a blast in Galaxy? Yes! 2) If so, can I download blast in galaxy? Yes! 3) If so, can I set up blast in my galaxy for analysis with only a particular species? Yes! But you need a local Galaxy instance, or a Galaxy instance where you can convince the administrator to install the Blast Tools. To install the Blast tools you can use the Tool Shed: http://wiki.galaxyproject.org/Tool%20Shed Here is the repository: http://toolshed.g2.bx.psu.edu/view/devteam/ncbi_blast_plus You can put arbitrary blast databases into Galaxy (have a look at the location files - *.loc), you also can create your own databases with Galaxy and search against that. Cheers, Bjoern Thank you very much ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
Re: [galaxy-user] FW: Tophat/Cuff parameters
Thanks a lot Jen! Irene From: Jennifer Jackson [j...@bx.psu.edu] Sent: Saturday, November 16, 2013 6:57 PM To: Irene Bassano Cc: galaxy-u...@bx.psu.edu Subject: Re: [galaxy-user] FW: Tophat/Cuff parameters Hi, Yes, the .py part of the wrapper you attached is how the tool is implemented in Galaxy. The .xml is what is displayed on the tool form. Together, these execute the command string for the job. Knowing the parameters used for a job run is definitely important and this is included in the interface. If you click on the info icon, the small circle i, for a dataset, the full command line is listed. Parameters set by the run are listed and can be compared to the manual. Anything not in the command string would be at default, just as if you were running the tool on the command line (not through Galaxy). This information captures execution parameters for reproducibility. Directly from the Galaxy run, but you can also use similar if you choose to run the tool on the command line (to use/add parameters not yet implemented in a Galaxy tool repository). There are a few tools that do not report the command line yet in the interface (older ones), but it can still be obtained independently by triggering an error, then submitting a bug report - a cc copy is sent to the reporter that contains it. Just put in the comments to ignore the bug submission. Not an ideal method (will be addressed), but is open for anyone to use, any tool. Hopefully this helps! No parameters are hidden to my knowledge. Best, Jen Galaxy team On Nov 16, 2013, at 2:44 AM, Irene Bassano b...@leeds.ac.ukmailto:b...@leeds.ac.uk wrote: Thanks again Jen, I just would like to get this point: if I want to modify them then I won’t be using Galaxy right, since there are few of them I can modify. All I would like to know is: are the hidden/chosen/not accessible parameters CHOSEN by Galaxy? If yes, is there any chance to know what has been chosen for these parameters which are not visible? Or did I understand that are default as written in the manual? Hope it’s clear, sorry for insisting but I need to know as I am doing an analysis for someone else and have to report all the options I have opted for! I cannot tell anything about those which are not listed I have read the link you sent me , but I cannot find all the missing options…I opened all the links on it an found only those already listed in the main cufflinks running page(see attachment).. Thanks again for your patience, Best, Irene From: Jennifer Jackson [mailto:j...@bx.psu.edu] Sent: 15 November 2013 20:59 To: Irene Bassano; 'galaxy-u...@bx.psu.edumailto:galaxy-u...@bx.psu.edu' Subject: Re: [galaxy-user] FW: Tophat/Cuff parameters Hello - Most of these are at defaults. The source code is the best place to find any that are hard-coded (if included, most likely done to manage resources). Again, any of of this could be modified if you have programming resource. The repository is owned by the devteam and in the Tool Shed, search with cuff here: http://usegalaxy.org/toolshed Best, Jen Galaxy team On 11/15/13 2:59 AM, Irene Bassano wrote: Hi Jen, Thanks again. Just to make it clear: if all the options are not present on galaxy but only some of them, does this mean that the absent ones have been set by galaxy dev? are these to be considered best settings not worth changing? I would like to learn a bit more and “play” with all options but if some of them wont affect the final reaults then is not worth changing them. Thanks, Irene From: Jennifer Jackson [mailto:j...@bx.psu.edu] Sent: 14 November 2013 21:43 To: galaxy-user Cc: Irene Bassano Subject: Tophat/Cuff parameters Hello, Yes, this is correct, not all parameters can be adjusted in the UI. Many can, especially with Tophat, but not all. The list of implemented parameters that will match the documentation is listed at the bottom of each of these tools. The UI form itself up top may have a slightly different human readable name, but most will include the parameter name -r, etc. To see all of the parameters on the forms: 1. Tophat/2 - open TopHat settings to use: Full parameter list 2. Cufflinks/merge/compare/diff - open or modify any listed on form to see full content This tool is in the Tool Shed (http://usegalaxy.org/toolshed), so if you had programming resource available, then these could certainly be modified. Development questions can go do the galaxy-...@bx.psu.edumailto:galaxy-...@bx.psu.edu mailing list, but really the best place to start is in our wiki: http://wiki.galaxyproject.org/Admin/Tools/ToolConfigSyntax http://wiki.galaxyproject.org/Tool%20Shed It would be really helpful if you sent questions directly to the galaxy-u...@bx.psu.edumailto:galaxy-u...@bx.psu.edu mailing list going forward. Thanks, Jen Galaxy team On 11/14/13 1:08 PM, Irene Bassano wrote: Hi Jen, thanks a lot for your reply. I am trying to apply some changes
[galaxy-user] Mean inner distance
Hi Vanessa, Mean inner distance can be thought of as being the estimated gap left between the two ends of the paired reads. This is from the manual (also at the bottom of the Tophat tool form): -r This is the expected (mean) inner distance between mate pairs. For, example, for paired end runs with fragments selected at 300bp, where each end is 50bp, you should set -r to be 200. There is no default, and this parameter is required for paired end runs. In short, take the insert size, subtract the length of both sequenced ends, and that is the Mean inner distance. Best, Jen Galaxy team On 11/18/13 10:08 AM, Vanessa Lattimore wrote: Hi Jen, I was hoping you would be able to clarify something for me. What is the mean inner distance between mate pairs in the TopHat tool? I can't find a consensus online on what it is and everything I have found seems to be guesses. My data was run on the HiSeq, and the average insert size was ~200 prior to all adaptors being removed. Do I go off this to determine the inner distance or is there a pipeline of tools I need to use to accurately determine it? Your help would be greatly appreciated! Many regards, Vanessa. -- Jennifer Hillman-Jackson http://galaxyproject.org ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
[galaxy-user] help for trim sequences
Hi, I am a galazy user and I want to trim exact sequences (not the location) from 5' end. Is there any tool I can use for this? For example, *AATGATACGGCGACCACCG **AACACTGCGTTTGCTGGCTTTG*ATG From this sequence, I want to remove *AATGATACGGCGACCACCG,* *so I can get**AACACTGCGTTTGCTGGCTTTG*ATG only. If I use trim sequences or FASTX trimmer, then it will be trimmed absolute position. It would be great help. Thank you so much! Best, *Seung Hee * ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
[galaxy-user] compute an expression on every row question
Hello, I am looking for the right way to do a computation using text manipulation, compute an expression on every row. I have a table consisting of 20 columns and about 15.000 rows. Column 1 is my untreated or control and I would like to normalize every other column to this control by simple division. As a result I would like to obtain a table in which column 1 is set to a value of 1 for every row, and the corresponding values in the other columns resulting from column x / column 1. I tried something like c2/c1,c3/c1,c4/c1... on a small testfile but that results in all normalized values being put into one column in brackets rather than being put into individual columns. What would be the right parameters? I also thought about creating a workflow consisting of successive divisions of the columns but that feels rather complicated. Is there an easier way? Any help would be much appreciated! Best, Tobias -- Tobias Hohenauer, PhD GCNA, Disease Mechanism Research Core RIKEN Brain Science Institute 2-1 Hirosawa, Wako-shi 351-0198 Japan ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
