Re: [galaxy-user] GTF-to-GFF3
Speaking of which, could a Galaxy developer look at adding these changes, please? https://bitbucket.org/galaxy/galaxy-central/issue/447/new-tools-to-de-interlace-fastq-mate-pair Thanks, Florent On 23/03/11 12:02, Jeremy Goecks wrote: Alternatively, we welcome community contributions to the Galaxy codebase, and we'd be happy to incorporate these tools if they came with functional tests and test data. ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
[galaxy-user] Fwd: Workflows with conditional statements
I filed an enhancement report since if the workflow conditional facility does not appear to exist in Galaxy: https://bitbucket.org/galaxy/galaxy-central/issue/547/conditional-workflow-steps Best, Florent Original Message Subject:Workflows with conditional statements Date: Wed, 18 May 2011 10:31:21 +1000 From: Florent Angly florent.an...@gmail.com To: galaxy-user@lists.bx.psu.edu galaxy-user@lists.bx.psu.edu Hi all, I was wondering if there is a way to put conditional statements in a Galaxy workflow. This would be useful, for example, in the case of a workflow that has an optional advanced option that the user can click. This advanced option would add some extra steps to the data processing. Another example of how this could be useful is if inside a workflow, the data needs to be processed differently based on the results of previous workflow steps. Say, you have a worflow that takes some sequences, and calculate their average length. Using a conditional statement, the workflow would put the data through DeBruijn assembler if the reads are small, but through a traditional Overlap-Layout-Consensus assembler if the reads are long. Are conditional statements possible in Galaxy workflows and I just don't know how to use them? Best, Florent ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] filtering fastq file according to qual score
Hi Haluk, By filtering, you mean removing reads? trimming their ends? or masking some of their bases? There are 3 tools under Generic FASTQ manipulation that may help you: Filter FASTQ reads by quality score and length FASTQ Quality Trimmer by sliding window FASTQ Masker by quality score Regards, Florent On 31/07/11 05:58, Haluk Dogan wrote: Hi, I am trying to filter my fastq file with the condition of if quality score of reads is less then min score. So far, I have tried both *fastq_quality_filter* and *Filter FASTQ under NGS: QC and manipulation** *but I was not be able to do it. In the following you can see my fastq file. @F4HZV5G02CX6WP rank=096 x=1092.0 y=1767.0 length=45 TTGAGCAGCGGCGTCACGGCGGCGGCCTCGGCGGCCGCATAGGCG + FFFIHFFDDBDA And these are quality scores. [37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 39, 37, 37, 35, 35, 33, 35, 32, 29] I want to filter bases if their quality scores are less than 33. Any help would be greatly appreciated. -- HD ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] filtering fastq file according to qual score
Hi Haluk, It is definitely not conventional to remove bases that have low quality, because this disrupts the DNA sequence and may introduce frameshifts. It is typically better to trim the ends of the sequence, or to remove it altogether if its quality does not match your requirements. Regards, Florent On 31/07/11 18:40, Haluk Dogan wrote: Hi Florent, I actually want to do removing respected bases if their quality score is less than my threshold. I had been able to do masking those bases by using FASTQ Masker by quality score tool. But I haven't gone even one step further for removing bases. After your reply, I got suspicious. Am I trying to do something wrong in theory? Thanks in advance. On Sun, Jul 31, 2011 at 6:07 AM, Florent Angly florent.an...@gmail.com mailto:florent.an...@gmail.com wrote: Hi Haluk, By filtering, you mean removing reads? trimming their ends? or masking some of their bases? There are 3 tools under Generic FASTQ manipulation that may help you: Filter FASTQ reads by quality score and length FASTQ Quality Trimmer by sliding window FASTQ Masker by quality score Regards, Florent On 31/07/11 05:58, Haluk Dogan wrote: Hi, I am trying to filter my fastq file with the condition of if quality score of reads is less then min score. So far, I have tried both *fastq_quality_filter* and *Filter FASTQ under NGS: QC and manipulation** *but I was not be able to do it. In the following you can see my fastq file. @F4HZV5G02CX6WP rank=096 x=1092.0 y=1767.0 length=45 TTGAGCAGCGGCGTCACGGCGGCGGCCTCGGCGGCCGCATAGGCG + FFFIHFFDDBDA And these are quality scores. [37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 39, 37, 37, 35, 35, 33, 35, 32, 29] I want to filter bases if their quality scores are less than 33. Any help would be greatly appreciated. -- HD ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server atusegalaxy.org http://usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ -- HD ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Simulating sequencing and removing redundant sequences
For read simulation, you may also want to give Grinder a try. I made a Galaxy wrapper for it (see in the toolshed: http://toolshed.g2.bx.psu.edu/) Florent On 20/09/11 18:46, Kevin Lam wrote: Hi Daniel, You would have multiple names for each sequence and that would be quite hard to display. I am sure someone thought through this. Since the sequence is the same, you can use the sequence to look back in the fastq file for read name. Although I am not sure how that would help you? Cheers Kevin On 20 September 2011 13:43, Daniel Sher ds...@sci.haifa.ac.il mailto:ds...@sci.haifa.ac.il wrote: Thanks Kevin. However, the collapse sequences replaces the original name of the sequences with a numerical code, and I need to keep the original names. Any other suggestions? Thanks Daniel On 20/09/2011 05:32, Kevin Lam wrote: Hi Daniel for 2) you may use the tools under NGS QC and manipulation FASTQ to FASTA http://main.g2.bx.psu.edu/tool_runner?tool_id=cshl_fastq_to_fasta converter followed by Collapse http://main.g2.bx.psu.edu/tool_runner?tool_id=cshl_fastx_collapser sequences On 19 September 2011 09:54, Kevin Lam ke...@aitbiotech.com mailto:ke...@aitbiotech.com wrote: For 1) you may refer to Simulated Dataset of Solexa - SEQanswers http://seqanswers.com/forums/showthread.php?t=806 Has anyone replied you for 2) ? On 18 September 2011 21:12, Daniel Sher ds...@sci.haifa.ac.il mailto:ds...@sci.haifa.ac.il wrote: Hello, I have two questions - I apologize if they are trivial.. 1) I want to simulate the amount of Illumina sequencing needed to sequence and assemble a known genome. Is there a way to randomly pick sequences of a specific length from a genome (either one available online or one I upload)? Something like pick 100bp randomly (either strand), move 400-500bp forward and pick another 100bp? 2) Is there a way to remove redundant sequences from a FASTA file without losing the original sequence names (as happens with collapse)? Thanks Daniel -- ~~~ Daniel Sher, PhD Department of Marine Biology Leon H. Charney School of Marine Sciences University of Haifa, Mt. Carmel 31905, Haifa, Israel Office+972-4-8240731 tel:%2B972-4-8240731 Lab+972-4-8288961 tel:%2B972-4-8288961 email:ds...@sci.haifa.ac.il mailto:ds...@sci.haifa.ac.il ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org http://usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ -- ~~~ Daniel Sher, PhD Department of Marine Biology Leon H. Charney School of Marine Sciences University of Haifa, Mt. Carmel 31905, Haifa, Israel Office+972-4-8240731 tel:%2B972-4-8240731 Lab+972-4-8288961 tel:%2B972-4-8288961 email:ds...@sci.haifa.ac.il mailto:ds...@sci.haifa.ac.il ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Problem with new tool shed
Hi Greg,
Thank you for your help. Your suggestion worked like a charm!
I was expecting to see an error because I did not create the
../shed_tool/ folder that contains the tools installed from the shed,
but I was happy to see that it was automatically created.
I have a few additional comments and questions though:
1/ In the universe_wsgi.ini file, maybe the tool_config_file parameter
could be renamed to tool_config_files (plural) to indicate that it takes
a list of files.
2/ It seems like the Tools Search box cannot find newly installed tools.
However, after I restart Galaxy, it works as intended again.
3/ In the Grinder wrapper, I relied on installing the wrapper under a
specific folder: ./tools/ngs simulation/grinder. The new wrapper
installation procedure installs the tools in the ../shed_tools/ folder
and the admins can choose under what category the tool is to be placed.
This means that my Grinder wrapper fails since it does not know where to
find the scripts it needs. Is there a way to get the directory where a
tool is installed? Here is an excerpt of the Grinder wrapper so you can
better understand what I am trying to do. This wrapper first runs
Grinder and then moves its files (the number of files is hard to
determine ahead of time) to a place where Galaxy will find them (see the
wiki page
http://wiki.g2.bx.psu.edu/Admin/Tools/Multiple%20Output%20Files under
section Number of Output datasets cannot be determined until tool run).
Thanks,
Florent
command
#set $tool_dir = os.path.join( os.path.abspath($__root_dir__),
'tools', 'ngs_simulation' )
#set $script1 = os.path.join( $tool_dir, 'stderr_wrapper.py' )
#set $script2 = os.path.join( $tool_dir,
'grinder_multiple_outputs.py' )
$script1
grinder
#if $reference_file.specify == builtin:
-reference_file ${ filter( lambda x: str( x[0] ) == str(
$reference_file.value ), $__app__.tool_data_tables[ 'all_fasta'
].get_fields() )[0][-1] }
#else if $reference_file.specify == uploaded:
-reference_file $reference_file.value
#end if
[...]
#if str($homopolymer_dist):
-homopolymer_dist $homopolymer_dist
#end if
#set $output_dir = $__new_file_path__
-output_dir $output_dir
#set $base_name = $output.id
-base_name $base_name
;
$script2 $output_dir $base_name
/command
On 04/10/11 22:55, Greg Von Kuster wrote:
Hello Florent,
Sorry for the confusion on this - we are preparing a new Galaxy distribution,
and the tool shed wiki has been written in preparation for it. The new
distribution will be available fairly soon, and the Galaxy News Brief will
include information about these new tool shed features. In any case, you have
already discovered that you can use in if you update your Galaxy instance to
the latest Galaxy development repository ( Galaxy central ).
The problem you see is most likely caused by your not having configured an
additional tool_config_file setting in your universe_wsgi.ini. Look for
something like following in your latest version of the universe_wsgi.ini.sample
that you got when you updated from Galaxy central.
# Locally installed tools and tools installed from tool sheds
tool_config_file = tool_conf.xml,shed_tool_conf.xml
If you add a new additional file name like shed_tool_conf.xml, you should not
have a problem installing from a tool shed. I'll have a fix for the bug you've
discovered shortly, but making this change will fix the behavior until then.
Let me know if you bump into any additional problems.
Thanks for finding this!
Greg Von Kuster
On Oct 4, 2011, at 2:53 AM, Florent Angly wrote:
Hi all,
I tried the latest stable version of Galaxy:
http://wiki.g2.bx.psu.edu/News%20Briefs/2011_08_30. This page has links to how
to use the new tool shed including how to automatically deploy tools from the
shed in a local Galaxy server.
The documentation mentioned some tool shed options available from the the admin
section of Galaxy but I could not locate these options in my instance of
galaxy. So my question is: Can one only take advantage of the tool deployment
from the shed in the development version of Galaxy? If so, I think the Tool
shed wiki should be more clear about this.
Then I tried the latest development version of Galaxy and could locate the tool shed deployment options. I attempted to install the Grinder wrapper
(http://toolshed.g2.bx.psu.edu/repository/manage_repository?sort=namewebapp=communityid=3d8312720a69a558f-deleted=Falseshow_item_checkboxes=falseasync=falseoperation=view_or_manage_repositoryf-free-text-search=grinderpage=1http://toolshed.g2.bx.psu.edu/repository/manage_repository?sort=namewebapp=communityid=3d8312720a69a558f-deleted=Falseshow_item_checkboxes=falseasync=falseoperation=view_or_manage_repositoryf-free-text-search=grinderpage=1)
but ran into an error that I am pasting below:
URL:
http://localhost:8080/admin
Re: [galaxy-user] Patch for better FASTQ description handling
I have had the chance to try the patch on several datasets and it looks good :) I reiterate my suggestion to pull the patch in galaxy-central. Best, Florent On 05/10/11 18:28, Florent Angly wrote: Hi, I have found some issue with the way FASTQ read description is handled by Galaxy utilities: https://bitbucket.org/galaxy/galaxy-central/issue/665/paired-end-code-mishandles-description-of Please consider pulling my patch, thanks, Florent ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Patch for better FASTQ description handling
Peter and Daniel, thanks for the comments. On 19/10/11 23:49, Peter Cock wrote: On Wed, Oct 19, 2011 at 2:31 PM, Daniel Blankenbergd...@bx.psu.edu wrote: Hi Florent, Sorry for the delay. I did try the patch out shortly after you contributed it, but it caused the functional to fail. I was able to fix the issue and allow the existing tests to start passing, but I've been bogged down lately and haven't been able to perform a more thorough review of the code. If you could provide tests with files (e.g. for the tools affected) that test the new functionality, that would be a great help. I'll have a look at that. The use of partition removes python compatibility for2.5, although this is a lesser/non-concern. I guess you could use split, but special case on there being no space. Also, I'm not entirely sold on having the Identifier line being parsed as identifier +space + description instead a single identifier line. That is the normal convention, just like with FASTA. http://dx.doi.org/10.1093/nar/gkp1137 The Bioperl and Biopython projects use this convention for FASTA and FASTQ files. This would mean that identifiers could not themselves contain spaces, but There is no standardization for identifiers (so they could technically have spaces?). Could two different reads be identified as Read A and Read B, but then would no longer be uniquely identifiable as each would then be identified as Read. If this added functionalilty were introduced as optional behavior (e.g. a user needs to click a checkbox on the tools to apply the id line splitting), these concerns can be mitigated. That is expected, @Read A and @Read B have the same identifier, Read. Peter, Florent, anyone else: I'd be very interested to hear your thoughts on the above, particularly in respect to know real-world data. For now, lets discount SRA data from this discussion. See also the new Illumina 1.8 naming convention where they dropped the /1 and /2 and hit it in the description. It should be tested, but I think Florent's patch will work here (while the current Galaxy behaviour won't). Peter I was not aware of this new naming. It seems like a terrible decision from Illumina because now both reads in a pair technically have the same ID (but a different description). Florent ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] FASTQ Quality Trimmer for PE Illumina?
Hi Joanna, During trimming, some of the reads may be removed from your dataset. Depending on what you need to do, you may or may not want to discard reads that don't have a mate mate anymore. If so, you might consider using the FASTQ de-interlacer and interlacer tools. Florent On 26/10/11 02:52, Kuehn, Joanna S [V MPM] wrote: Hello, I was wondering, can Galaxy’s FASTQ Quality Trimmer tool be used on Illumina paired-end data? Would the forward and reverse read files need to be processed separately and be un-joinable afterwards for filtering? Thank you, Joanna ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Patch for better FASTQ description handling
On 19/10/11 23:31, Daniel Blankenberg wrote: Sorry for the delay. I did try the patch out shortly after you contributed it, but it caused the functional to fail. I was able to fix the issue and allow the existing tests to start passing, but I've been bogged down lately and haven't been able to perform a more thorough review of the code. If you could provide tests with files (e.g. for the tools affected) that test the new functionality, that would be a great help. Hi Dan, I finally addressed your comments. See the updated pull request: https://bitbucket.org/galaxy/galaxy-central/pull-request/8/paired-end-code-mishandles-description-of Best, Florent ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
[galaxy-user] Recent problematic change in the Galaxy Toolshed
Hi, I just tried to upload a new version of the Grinder Galaxy wrapper to the Galaxy ToolShed and am encountering difficulties that I did have in previous versions. When I upload my .tar.gz file, the upload is aborted and I get the error: 'GalaxyWebUITransaction' object has no attribute 'tool_data_tables' When I remove my tool_data_table_conf.xml.sample file from the tarball and try re-uploading, I get this warning: The file 'grinder-galaxy-0.4.3.tar.gz' has been successfully uncompressed and uploaded to the repository. 1 files were removed from the repository root. Metadata cannot be defined for revision 'c9fee6113b0d' so this revision cannot be automatically installed into a local Galaxy instance. Correct the following problems and reset metadata. grinder.xml - This file requires an entry in the tool_data_table_conf.xml file. Upload a file named tool_data_table_conf.xml.sample to the repository that includes the required entry to resolve this issue. These two messages are contradictory. Also, if I am not allowed to define a new datatable with this name, how I am suppose to have a tool use data tables? Thanks, Florent ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Recent problematic change in the Galaxy Toolshed
Thank you very much Greg. Florent On 19/01/12 02:50, Greg Von Kuster wrote: Hello Florent, Sorry you encountered this issue. It results from a recently introduce typo in the tool shed code when uploading into a repo that depends on tool data table entries. I've corrected the problem in the tool shed. I also inspected your repository that contains the grinder tool and noticed that the state of the repository was such that the tool_data_table_conf.xml.sample file was added but not committed, so I committed it for you. I also downloaded and installed this repository into my local instance with no problems, so I believe your grinder repository is now in a good state. Thanks very much for reporting this issue. Greg Von Kuster On Jan 17, 2012, at 8:43 PM, Florent Angly wrote: Hi, I just tried to upload a new version of the Grinder Galaxy wrapper to the Galaxy ToolShed and am encountering difficulties that I did have in previous versions. When I upload my .tar.gz file, the upload is aborted and I get the error: 'GalaxyWebUITransaction' object has no attribute 'tool_data_tables' When I remove my tool_data_table_conf.xml.sample file from the tarball and try re-uploading, I get this warning: The file 'grinder-galaxy-0.4.3.tar.gz' has been successfully uncompressed and uploaded to the repository. 1 files were removed from the repository root. Metadata cannot be defined for revision 'c9fee6113b0d' so this revision cannot be automatically installed into a local Galaxy instance. Correct the following problems and reset metadata. grinder.xml - This file requires an entry in the tool_data_table_conf.xml file. Upload a file named tool_data_table_conf.xml.sample to the repository that includes the required entry to resolve this issue. These two messages are contradictory. Also, if I am not allowed to define a new datatable with this name, how I am suppose to have a tool use data tables? Thanks, Florent ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ Greg Von Kuster Galaxy Development Team g...@bx.psu.edu ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
