Re: [galaxy-user] run Bowtie to estimate Mean Inner Distance between Mate Pairs
Hi All,
Thank you for your help. I understand how to do now.
Jianguang
From: rshar...@bx.psu.edu [rshar...@bx.psu.edu]
Sent: Tuesday, August 21, 2012 11:15 AM
To: galaxy-user@lists.bx.psu.edu
Cc: Du, Jianguang
Subject: Re: [galaxy-user] run Bowtie to estimate Mean Inner Distance between
Mate Pairs
Howdy Jianguang,
There's a more complete description of the SAM format in "The Sequence
Alignment/Map format and SAMtools", Li et al, Bioinformatics (2009). And
you can find the latest specification for the format at
samtools.sourceforge.net .
In the spec, the terminology for the ISIZE field has been changed to TLEN,
template length, to allow for sequencing technologies that produce more
than two sequenced segments. The description there is "the number of
bases from the leftmost mapped base to the rightmost mapped base".
So I think to convert to "inner distance between mate pairs" you would
typically take ISIZE and subtract the lengths of the mates. Note that for
some technologies that value could be negative (which just means the mates
overlap). You might need to take into account whether the mates have been
mapped with proper orientation-- for example, if an inversion has flipped
one mate it has also carried that mate closer to or farther from the
other.
Bob H
> Hello Jianguang,
>
> On the Bowtie tool form itself, please find this text:
>
> Outputs
>
> The output is in SAM format, and has the following columns:
>
>Column Description
>
> 1 QNAME Query (pair) NAME
> 2 FLAG bitwise FLAG
> 3 RNAME Reference sequence NAME
> 4 POS1-based leftmost POSition/coordinate of clipped sequence
> 5 MAPQ MAPping Quality (Phred-scaled)
> 6 CIGAR extended CIGAR string
> 7 MRNM Mate Reference sequence NaMe ('=' if same as RNAME)
> 8 MPOS 1-based Mate POSition
> 9 ISIZE Inferred insert SIZE
> 10 SEQquery SEQuence on the same strand as the reference
> 11 QUAL query QUALity (ASCII-33 gives the Phred base quality)
> 12 OPTvariable OPTional fields in the format TAG:VTYPE:VALUE
>
>
> The value of ISIZE is the total insert size for this read pair.
>
>
> Hopefully this helps!
>
> Jen
> Galaxy team
>
> On 8/16/12 2:34 PM, Du, Jianguang wrote:
>> Dear All,
>>
>> In order to figure out the Mean Inner Distance between Mate Pairs of my
>> paired-end RNA-seq datasets, I ran Bowtie (Map with Bowtie for Illumina)
>> with both forward and reverse datasets and mouse mm9 as reference
>> genome. Below I list the Bowtie output for only one pair of reads (I put
>> the fields on the left side):
>>
>> For the forward read
>> ...snip...
>> Is the ISIZE the insert size? The difference between POS and MPOS is
>> 145bp, which is 36bp shorter than ISIZE (181). My question is: if
>> ISIZE does mean insert size, how should I convert INSIZE into Mean Inner
>> Distance between Mate Pairs?
>>
>> Thanks,
>>
>> Jianguang Du
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org. Please keep all replies on the list by
using "reply all" in your mail client. For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:
http://lists.bx.psu.edu/listinfo/galaxy-dev
To manage your subscriptions to this and other Galaxy lists,
please use the interface at:
http://lists.bx.psu.edu/
Re: [galaxy-user] run Bowtie to estimate Mean Inner Distance between Mate Pairs
Howdy Jianguang,
There's a more complete description of the SAM format in "The Sequence
Alignment/Map format and SAMtools", Li et al, Bioinformatics (2009). And
you can find the latest specification for the format at
samtools.sourceforge.net .
In the spec, the terminology for the ISIZE field has been changed to TLEN,
template length, to allow for sequencing technologies that produce more
than two sequenced segments. The description there is "the number of
bases from the leftmost mapped base to the rightmost mapped base".
So I think to convert to "inner distance between mate pairs" you would
typically take ISIZE and subtract the lengths of the mates. Note that for
some technologies that value could be negative (which just means the mates
overlap). You might need to take into account whether the mates have been
mapped with proper orientation-- for example, if an inversion has flipped
one mate it has also carried that mate closer to or farther from the
other.
Bob H
> Hello Jianguang,
>
> On the Bowtie tool form itself, please find this text:
>
> Outputs
>
> The output is in SAM format, and has the following columns:
>
>Column Description
>
> 1 QNAME Query (pair) NAME
> 2 FLAG bitwise FLAG
> 3 RNAME Reference sequence NAME
> 4 POS1-based leftmost POSition/coordinate of clipped sequence
> 5 MAPQ MAPping Quality (Phred-scaled)
> 6 CIGAR extended CIGAR string
> 7 MRNM Mate Reference sequence NaMe ('=' if same as RNAME)
> 8 MPOS 1-based Mate POSition
> 9 ISIZE Inferred insert SIZE
> 10 SEQquery SEQuence on the same strand as the reference
> 11 QUAL query QUALity (ASCII-33 gives the Phred base quality)
> 12 OPTvariable OPTional fields in the format TAG:VTYPE:VALUE
>
>
> The value of ISIZE is the total insert size for this read pair.
>
>
> Hopefully this helps!
>
> Jen
> Galaxy team
>
> On 8/16/12 2:34 PM, Du, Jianguang wrote:
>> Dear All,
>>
>> In order to figure out the Mean Inner Distance between Mate Pairs of my
>> paired-end RNA-seq datasets, I ran Bowtie (Map with Bowtie for Illumina)
>> with both forward and reverse datasets and mouse mm9 as reference
>> genome. Below I list the Bowtie output for only one pair of reads (I put
>> the fields on the left side):
>>
>> For the forward read
>> ...snip...
>> Is the ISIZE the insert size? The difference between POS and MPOS is
>> 145bp, which is 36bp shorter than ISIZE (181). My question is: if
>> ISIZE does mean insert size, how should I convert INSIZE into Mean Inner
>> Distance between Mate Pairs?
>>
>> Thanks,
>>
>> Jianguang Du
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org. Please keep all replies on the list by
using "reply all" in your mail client. For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:
http://lists.bx.psu.edu/listinfo/galaxy-dev
To manage your subscriptions to this and other Galaxy lists,
please use the interface at:
http://lists.bx.psu.edu/
Re: [galaxy-user] run Bowtie to estimate Mean Inner Distance between Mate Pairs
Hello Jianguang,
On the Bowtie tool form itself, please find this text:
Outputs
The output is in SAM format, and has the following columns:
Column Description
1 QNAME Query (pair) NAME
2 FLAG bitwise FLAG
3 RNAME Reference sequence NAME
4 POS1-based leftmost POSition/coordinate of clipped sequence
5 MAPQ MAPping Quality (Phred-scaled)
6 CIGAR extended CIGAR string
7 MRNM Mate Reference sequence NaMe ('=' if same as RNAME)
8 MPOS 1-based Mate POSition
9 ISIZE Inferred insert SIZE
10 SEQquery SEQuence on the same strand as the reference
11 QUAL query QUALity (ASCII-33 gives the Phred base quality)
12 OPTvariable OPTional fields in the format TAG:VTYPE:VALUE
The value of ISIZE is the total insert size for this read pair.
Hopefully this helps!
Jen
Galaxy team
On 8/16/12 2:34 PM, Du, Jianguang wrote:
Dear All,
In order to figure out the Mean Inner Distance between Mate Pairs of my
paired-end RNA-seq datasets, I ran Bowtie (Map with Bowtie for Illumina)
with both forward and reverse datasets and mouse mm9 as reference
genome. Below I list the Bowtie output for only one pair of reads (I put
the fields on the left side):
For the forward read
QNAME: SRR322837.8.1
FLAG:99
RNAME:chr1
POS:163761156
MAPQ:255
CIAGR:36M
MRNM:=
MPOS:163761301
ISIZE:181
SEQ:NTGGATACTAGCCATAAATGAATT
QUAL:%(,,')(())@@@2235885<<2@@@##
OPT:XA:i:1MD:Z:0A35NM:i:1
For the reverse read
QNAME: SRR322837.8.2
FLAG:147
RNAME:chr1
POS:163761301
MAPQ:255
CIAGR:36M
MRNM:=
MPOS:163761156
ISIZE:-181
SEQ:TATTATGTCAATCTATGAAGAAGGACGGCGAGGTGA
QUAL:GDBE@B>EEGDB=BD-=GG>GGGEDDGhttp://lists.bx.psu.edu/listinfo/galaxy-dev
To manage your subscriptions to this and other Galaxy lists,
please use the interface at:
http://lists.bx.psu.edu/
--
Jennifer Jackson
http://galaxyproject.org
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org. Please keep all replies on the list by
using "reply all" in your mail client. For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:
http://lists.bx.psu.edu/listinfo/galaxy-dev
To manage your subscriptions to this and other Galaxy lists,
please use the interface at:
http://lists.bx.psu.edu/
[galaxy-user] run Bowtie to estimate Mean Inner Distance between Mate Pairs
Dear All, In order to figure out the Mean Inner Distance between Mate Pairs of my paired-end RNA-seq datasets, I ran Bowtie (Map with Bowtie for Illumina) with both forward and reverse datasets and mouse mm9 as reference genome. Below I list the Bowtie output for only one pair of reads (I put the fields on the left side): For the forward read QNAME: SRR322837.8.1 FLAG:99 RNAME: chr1 POS: 163761156 MAPQ:255 CIAGR: 36M MRNM:= MPOS:163761301 ISIZE: 181 SEQ: NTGGATACTAGCCATAAATGAATT QUAL:%(,,')(())@@@2235885<<2@@@## OPT: XA:i:1 MD:Z:0A35 NM:i:1 For the reverse read QNAME: SRR322837.8.2 FLAG:147 RNAME: chr1 POS: 163761301 MAPQ:255 CIAGR: 36M MRNM:= MPOS:163761156 ISIZE: -181 SEQ: TATTATGTCAATCTATGAAGAAGGACGGCGAGGTGA QUAL:GDBE@B>EEGDB=BD-=GG>GGGEDDG___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
