Hi Dominique,
Glad that helped. And yes, you can merge many file types that are
text-based with the tool 'Text Manipulation - Concatenate datasets.
Sometimes you will need to convert to format tabular first, and then
back to the desired format (fasta, gtf, etc.) after.
Take care,
Jen
Galaxy team
On 9/19/13 5:51 AM, D. A. Cowart wrote:
Thank you Jennifer, this helped tremendously. I completely missed the
barcode splitter too.
One other question: do you know if it is possible to merge different
fasta files on Galaxy? Say, I wanted to merge those tagged files back
to one complete fasta file.
Best,
Dominique Cowart
On Thu, Sep 19, 2013 at 12:19 AM, Jennifer Jackson j...@bx.psu.edu
mailto:j...@bx.psu.edu wrote:
Hello Dominique,
Yes, this can be done. Here is the process -
Start by splitting up the data by using the 'NGS: QC and
manipulation - Barcode Splitter tool. The result files will be
available as links. These can be copied and added to the Get Data
- Upload File tool in the text box, in batch, and each will
loaded as a dataset. Copying them into a simple text file, then
pasting into the Upload tool all at once is a quick way to do
this, or you can do one by one.
Once you have the individual files as datasets, you probably will
want to rename them to better keep track of which barcode/tag they
represent. Click on the pencil icon in the upper right corner of
each dataset to do this on the Edit Attributes form.
Next, the idea is to convert the fasta dataset to tabular, add in
a column with the _Tag1 information, merge the original
identifier column with the new tag column, cut the columns to
rearrange - (you want just the new merged identifier and the
original fasta sequence - leaving behind the two columns with the
original identifier + tag), then covert back from tabular to fasta
format. Use the tools in 'Text Manipulation' and 'FASTA
manipulation' to do these operations. I would normally suggest
creating/using a workflow at this point, but as the tags will all
be different, and the Add column step is in the middle of the
processing, this is probably not worth it.
Hopefully this helps!
Jen
Galaxy team
On 9/18/13 7:36 AM, D. A. Cowart wrote:
Hello,
I need to perform an action (or series of actions) on an 454
dataset using Galaxy, and have not been able to figure out the
necessary steps, even after looking through the toolbar
expressions and using custom search.
My file is a fasta and has the standard format:
GNJQDEZ01A940A
CTGAGTCAGGTCAACAATCATAAGATATTGGCACCATGTACCTGTGGTTCTCGTTTCC
ATGTTA
GNJQDEZ01BJYQZ
CTGAGTCAGGTCAACAATCATAAGACATCGGCTCTCTATATTTAATATTGGT
Each of the 100,000 sequences within this file contains a
specific tag, which is the first 8 nucleotides.
There are 19 tags total. I would like to identify these tags and
add an identifier of the tag to the sequence name.
Therefore, if I am looking for the first tag (CTGAGTCA), the
output would look like:
GNJQDEZ01A940A_*Tag1*
*CTGAGTCA*GGTCAACAATCATAAGATATTGGCACCATGTACCTGTGGTTCTCGTTTCC
ATGTTA
Is it possible to achieve this using Galaxy? If possible, could
you kindly suggest tools to use.
Thank you in advance,
Dominique Cowart
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
atusegalaxy.org http://usegalaxy.org. Please keep all replies on the
list by
using reply all in your mail client. For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:
http://lists.bx.psu.edu/listinfo/galaxy-dev
To manage your subscriptions to this and other Galaxy lists,
please use the interface at:
http://lists.bx.psu.edu/
To search Galaxy mailing lists use the unified search at:
http://galaxyproject.org/search/mailinglists/
--
Jennifer Hillman-Jackson
http://galaxyproject.org
--
Jennifer Hillman-Jackson
http://galaxyproject.org
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org. Please keep all replies on the list by
using reply all in your mail client. For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:
http://lists.bx.psu.edu/listinfo/galaxy-dev
To manage your subscriptions to this and other Galaxy lists,
please use the interface at:
http://lists.bx.psu.edu/
To search Galaxy mailing lists use the unified search at:
http://galaxyproject.org/search/mailinglists/